Prev. |  Human A to Z list >  R >  RBBP7 > 

ARe81G10 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR072554
Clone Name ARe81G10
Clone info. Plasmid clone of human RBBP7 cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GGGGCTGGGAGGCGCGGGTTGAAAAGTCTCGTTCCAAGTTTGGAGAGAGAGAGAAGAGCG
Sequence, submitted(2) n.a.
 
Sequence, refered NM_002893.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RBBP7 (NCBI Gene 5931)  other clone of RBBP7 in our bank
Synonyms RbAp46
Protein Name RB binding protein 7, chromatin remodeling factor
KEGG hsa:5931
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR072554 ARe81G10 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.05.24

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl