Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RBBP7

Gene ID (NCBI) 5931
Gene Symbol RBBP7
Protein Name RB binding protein 7, chromatin remodeling factor
Synonyms RbAp46
Databases KEGG hsa:5931 |  NCBI Gene 5931
Featured content Ortholog resources in the DNA Bank (KEGG orthology K11659)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072554 ARe81G10 pKA1U5 NM_002893.3  
GGGGCTGGGAGGCGCGGGTTGAAAAGTCTCGTTCCAAGTTTGGAGAGAGAGAGAAGAGCG
HKR076828 ARe92B04 pKA1U5 NM_002893.3  
GGGGCTGGGAGGCGCGGGTTGAAAAGTCTCGTTCCAAGTTTGGAGAGAGAGAGAAGAGCG
HKR260214 ARiS150I22 pGCAP10 NM_002893.3  
GGAGAGAGAAGAGCGCCTCAGACCTCGGTACCCGCGAGCGGGGAGGAGGCAGGAAAGAAG
HKR362976 RBd07H08 pGCAP10 NM_002893.3  
GAGCTGCCTGGGCGGGCTGGGAGGCGCGGGTTGAAAAGTCTCGTTCCAAGTTTGGAGAGA
HKR387601 RBd69A01 pGCAP10 NM_002893.3  
GACTTTTCCCAGGGCGGATGCGCCTGCGCTCAGCTGCCTGGGCGGGCTGGGAGGCGCGGG
HKR420405 RBdS051A05 pGCAP10 NM_002893.3  
GGCGCTCAGCTGCCTGGGCGGGCTGGGAGGCGCGGGTTGAAAAGTCTCGTTCCAAGTTTG
HKR420431 RBdS051B07 pGCAP10 NM_002893.3  
GGTTCCAAGTTTGGAGAGAGAGAGAAGAGCGCCTCAGACCTCGGTACCCGCGAGCGGGGA
HKR420583 RBdS051H15 pGCAP10 NM_002893.3  
GGTTCCAAGTTTGGAGAGAGAGAGAAGAGCGCCTCAGACCTCGGTACCCGCGAGCGGGGA
HKR428211 RBdS070I19 pGCAP10 NM_002893.3  
NNAGCTANCTGGNNNNNCTGGNAGGCGCGGGTTGAAAANTCTCGTTCCAAGTTTGGAGAG
HKR433355 RBdS083G11 pGCAP10 NM_002893.3  
GAGACCCGCCTCTCCGCCTCCTCTCACTTTTCCCAGGGCGGATGCGCCTGCGCTCAGCTG
HKR442182 RBdS105H14 pGCAP10 NM_002893.3  
GAGCTGCCTGGGCGGGCTGGGAGGCGCGGGTTGAAAAGTCTCGTTCCAAGTTTGGAGAGA
HKR470925 RBdS177F05 pGCAP10 NM_002893.3  
GCCCNNCCCGNCCNCGGNNNNNAGGGNNNNNNNNNANNNNCANNNCNNNGTTNTGGAAAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl