Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00469

HP ID(1) HP00469
Gene ID(2) 6232
Gene Symbol finder RPS27
Protein Name ribosomal protein S27
RefSeq NM_001030.4
Length of RefSeq (bp) 361
Chromosome 1q21
Reference DDBJ accession
UniGene Hs.546291

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01F04 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACNTGCCTCTCGCAAAGGATCTCCTT
ARe03A09 pKA1U5 TGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
ARe03G09 pKA1U5 GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe08C09 pKA1U5 GTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTCA
ARe08G08 pKA1U5 GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe09G09 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe12B10 pKA1U5 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARe13H06 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe15H02 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACNTGCCTCTCGCAAAGGATCTCCTT
ARe17F07 pKA1U5 GCCTTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
ARe18A01 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe18A11 pKA1U5 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARe20F12 pKA1U5 TGCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe26D11 pKA1U5 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARe32B09 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe38G09 pKA1U5 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARe41D12 pKA1U5 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARe43C08 pKA1U5 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARe43C11 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe45G07 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe53F08 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe58A04 pKA1U5 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARe59A08 pKA1U5 GCTTTCCGGCGGGGACGACCTACGCCACACGAGAACATGCCTCTCGCNAAGGATCTCCTT
ARe61E08 pKA1U5 TGCCCTTTCCGGCGGTGACGACCTACGCACACGCCCANCATGCCTCTCGCAAAGGATCTC
ARe67B04 pKA1U5 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARe71A02 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe71D10 pKA1U5 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARe74A07 pKA1U5 GCTTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
ARe83C02 pKA1U5 ATCCTGGCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATC
ARe84D07 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe84F06 pKA1U5 GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe85A05 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe87A01 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe87C10 pKA1U5 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARe87G09 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARe88E07 pKA1U5 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARe95E08 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARf04C02 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARf04E03 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARf05C04 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi03D07 pGCAP10 GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi04F02 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARi04G08 pGCAP10 GCTTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
ARi13A01 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi14H09 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi19E08 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARi19F02 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi19H09 pGCAP10 TGCTTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
ARi20B08 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi22B12 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi23B01 pGCAP10 CGGCCGGCCGATGCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAA
ARi23H11 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi24D06 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi24G07 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARi30F09 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARi33E05 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARi35B09 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARi47H07 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi52A08 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi53H07 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi54E05 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARi55C07 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi55D08 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi56B07 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi57H12 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi58C03 pGCAP10 GCCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
ARi66B07 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi66F02 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARi71G05 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARiS008A17 pGCAP10 GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARiS008M07 pGCAP10 GCTTTCCGGCGGTNNCGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARiS020B03 pGCAP10 TGCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
ARiS020D08 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARiS020D23 pGCAP10 CGGCCGGCCGATGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCA
ARiS020E16 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARiS020J11 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARiS020O06 pGCAP10 GGGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
ARiS023N21 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTGACATTAACTCCAGGGAC
ARiS045G08 pGCAP10 TGCTATAAAATCACCACGGTCTTTAGCCATGCACAAACGGTAGTTTTGTGTGTTGGCTGC
ARiS045I17 pGCAP10 GCCTTTTCCGGCGGTGACNACCTACCCACACGAAAACATGCCTCTNGCAAAGGATCTCCT
ARiS049C04 pGCAP10 CCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARiS085J13 pGCAP10 GCCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
ARiS088B14 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARiS096E18 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARiS096J18 pGCAP10 GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARiS096O07 pGCAP10 GCCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
ARiS118C11 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARiS118N05 pGCAP10 GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARiS122M24 pGCAP10 GTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTCA
ARiS161I22 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARiS191A24 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARiS191B03 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARiS191H20 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARiS191O01 pGCAP10 GCTTTTTTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATC
ARiS194B19 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
ARiS194F14 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBb01A01 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBb02D06 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBb04F12 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBb04G12 pKA1U5 GCCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
RBb06B05 pKA1U5 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBb07B04 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBb07F01 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACNTGCCTCTCGCAAAGGATCTCCTT
RBb10D03 pKA1U5 GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBb10F07 pKA1U5 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBb12C11 pKA1U5 ATCCTGGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGAT
RBb14F09 pKA1U5 GCCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
RBb16D10 pKA1U5 ATCCTGGGCTCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAG
RBb17A06 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBb17H01 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBb20D09 pKA1U5 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBb24E02 pGCAP1 GCTTTCCGGCGGGTGACGACCTACGCCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
RBb25H10 pGCAP1 GTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTCATC
RBb27B07 pGCAP1 GGCGCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
RBb29G06 pGCAP1 GTTCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
RBb33F01 pGCAP1 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTTNGCAAAGGATCTCCT
RBb35D12 pGCAP1 TGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
RBb41C03 pGCAP1 CCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBb41C05 pGCAP1 CCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBb42D01 pGCAP1 GTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTCATC
RBb45E03 pGCAP1 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBb47C07 pGCAP1 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBb48A02 pGCAP1 AGGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
RBb52C08 pGCAP1 GCCTTTCCGGCGGGTGACGACCTACGCACACGTAGAACATGCCTCTCGCAAAGGATCTCC
RBb54A06 pGCAP1 TGGCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
RBb55G02 pGCAP1 GCTTTCCGGCGGTGACGACCTACGCACACGAGTAACATGCCTCTTCGCAAAGGATCTCCT
RBb58C12 pGCAP1 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTTCGCAAAGGATCTCCT
RBb59D09 pGCAP1 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBb65C02 pGCAP1 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBb69A01 pGCAP1 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd01A09 pGCAP10
RBd04D08 pGCAP10 CGGCCGGCCGATGCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCA
RBd05A06 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd06F10 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd07D09 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd07F08 pGCAP10 GGCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd07G03 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd08D06 pGCAP10 GCCTTTCCGGCGGTGACCACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd08D07 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd10B02 pGCAP10 GCCTTTCCCCTGGCGACGACCTACACGGAAGAGAACGTGCCTCTCGCAAAGGATCACCTT
RBd10D01 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd13B10 pGCAP10 GCCTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBd13D12 pGCAP10 TGGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
RBd14B01 pGCAP10 GTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBd14H11 pGCAP10
RBd15G09 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd19C10 pGCAP10 GCCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
RBd23C09 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBd24D12 pGCAP10 GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd26E09 pGCAP10 GTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBd27H12 pGCAP10 CGGCCGGCCGATGCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAA
RBd29B06 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd29H07 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBd30D01 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd33H08 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBd33H09 pGCAP10 GAGGGGAGACGCTGAGGGCGGAGGGGGCGAGCGGGACCCCGAGTCCGGAGAAAGGCCCGG
RBd34H10 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBd35H01 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd36G02 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBd37A08 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBd37E09 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBd41D05 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBd46A06 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd46A12 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd55E05 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCNNAAAGGATCTCCTT
RBd55G07 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCNGNNNGTGCTTTGGTCCAG
RBd55H07 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCNNNNAAAGGATCTCCTT
RBd62A12 pGCAP10 GCCTTTCCGGCGGTGACGACCTNGGNNACNGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd65H02 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd66H05 pGCAP10 GCCTTTCCGGNGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd68F02 pGCAP10 GGCNCCNTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTC
RBd70E05 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd71F10 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd81D03 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd82E11 pGCAP10 TGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
RBd83A06 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd83G02 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBd84G08 pGCAP10 GCCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
RBd86E11 pGCAP10 AGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
RBd93C07 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd94B07 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd94D12 pGCAP10 CGGCCGGCCGATGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCA
RBd95B04 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd95C11 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBd96A06 pGCAP10 GGCTTTCGCTCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAG
RBd99E12 pGCAP10 GCCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
RBdS007A17 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS007B09 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS014A16 pGCAP10 GCCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
RBdS014C07 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBdS015A07 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBdS015A14 pGCAP10 GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS015C18 pGCAP10 GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS015D16 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS015M15 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBdS022N11 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS040D16 pGCAP10 GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS040G11 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS070H24 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBdS075D19 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS075G22 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBdS075L09 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS075O11 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBdS083C13 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS083J22 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS083O05 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS104B17 pGCAP10 GTTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS104B22 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS104I19 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS104K21 pGCAP10 GCTTTTTTCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGA
RBdS105I18 pGCAP10 GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS110C18 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS110G16 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBdS110I09 pGCAP10 GCCTTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
RBdS110N14 pGCAP10 GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCNNAGGATCTCCTT
RBdS132N18 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBdS132N22 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS154G18 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS156B10 pGCAP10 GCCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
RBdS156F13 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS156O06 pGCAP10 TGGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
RBdS177F07 pGCAP10 GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
RBdS177G19 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
RBdS187H14 pGCAP10 GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl