Prev. |  KEGG KO K02978 > 

RIKEN DNA Bank Human Resource - RPS27

Gene ID NCBI Gene 6232 |  KEGG hsa:6232
Gene Symbol RPS27
Protein Name ribosomal protein S27
Synonyms DBA17|MPS-1|MPS1|S27
Ortholog resources KEGG ortholog (KEGG orthology K02978) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084955 IRAL012G11 pOTB7 BC002658 NM_001030 Full
HGY103122 IRAL057N10 pDNR-LIB BC070219 NM_001030 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040524 ARe01F04 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACNTGCCTCTCGCAAAGGATCTCCTT
HKR041209 ARe03A09 pKA1U5 NM_001030.4  
TGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR041353 ARe03G09 pKA1U5 NM_001030.4  
GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR043257 ARe08C09 pKA1U5 NM_001030.4  
GTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTCA
HKR043352 ARe08G08 pKA1U5 NM_001030.4  
GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR043753 ARe09G09 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR044834 ARe12B10 pKA1U5 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR045374 ARe13H06 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR046170 ARe15H02 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACNTGCCTCTCGCAAAGGATCTCCTT
HKR046927 ARe17F07 pKA1U5 NM_001030.4  
GCCTTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
HKR047201 ARe18A01 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR047211 ARe18A11 pKA1U5 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR048132 ARe20F12 pKA1U5 NM_001030.4  
TGCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR050483 ARe26D11 pKA1U5 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR052833 ARe32B09 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR055353 ARe38G09 pKA1U5 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR056484 ARe41D12 pKA1U5 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR057256 ARe43C08 pKA1U5 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR057259 ARe43C11 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR058151 ARe45G07 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR061328 ARe53F08 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR063204 ARe58A04 pKA1U5 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR063608 ARe59A08 pKA1U5 NM_001030.4  
GCTTTCCGGCGGGGACGACCTACGCCACACGAGAACATGCCTCTCGCNAAGGATCTCCTT
HKR064504 ARe61E08 pKA1U5 NM_001030.4  
TGCCCTTTCCGGCGGTGACGACCTACGCACACGCCCANCATGCCTCTCGCAAAGGATCTC
HKR066828 ARe67B04 pKA1U5 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR068402 ARe71A02 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR068482 ARe71D10 pKA1U5 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR069607 ARe74A07 pKA1U5 NM_001030.4  
GCTTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR073250 ARe83C02 pKA1U5 NM_001030.4  
ATCCTGGCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATC
HKR073679 ARe84D07 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR073726 ARe84F06 pKA1U5 NM_001030.4  
GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR074005 ARe85A05 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR074801 ARe87A01 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR074858 ARe87C10 pKA1U5 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR074953 ARe87G09 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR075303 ARe88E07 pKA1U5 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR078104 ARe95E08 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR081650 ARf04C02 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR081699 ARf04E03 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR082052 ARf05C04 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR161279 ARi03D07 pGCAP10 NM_001030.4  
GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR161722 ARi04F02 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR161752 ARi04G08 pGCAP10 NM_001030.4  
GCTTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR165201 ARi13A01 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR165777 ARi14H09 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR167704 ARi19E08 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR167722 ARi19F02 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR167777 ARi19H09 pGCAP10 NM_001030.4  
TGCTTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
HKR168032 ARi20B08 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR168836 ARi22B12 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR169225 ARi23B01 pGCAP10 NM_001030.4  
CGGCCGGCCGATGCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAA
HKR169379 ARi23H11 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR169678 ARi24D06 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR169751 ARi24G07 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR172129 ARi30F09 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR173301 ARi33E05 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR174033 ARi35B09 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR178975 ARi47H07 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR180808 ARi52A08 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR181375 ARi53H07 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR181701 ARi54E05 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR182055 ARi55C07 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR182080 ARi55D08 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR182431 ARi56B07 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR182980 ARi57H12 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR183251 ARi58C03 pGCAP10 NM_001030.4  
GCCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR186431 ARi66B07 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR186522 ARi66F02 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR188549 ARi71G05 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR203217 ARiS008A17 pGCAP10 NM_001030.4  
GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR203495 ARiS008M07 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTNNCGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR208027 ARiS020B03 pGCAP10 NM_001030.4  
TGCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR208080 ARiS020D08 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR208095 ARiS020D23 pGCAP10 NM_001030.4  
CGGCCGGCCGATGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCA
HKR208112 ARiS020E16 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR208227 ARiS020J11 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR208342 ARiS020O06 pGCAP10 NM_001030.4  
GGGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
HKR209533 ARiS023N21 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTGACATTAACTCCAGGGAC
HKR218152 ARiS045G08 pGCAP10 NM_001030.4  
TGCTATAAAATCACCACGGTCTTTAGCCATGCACAAACGGTAGTTTTGTGTGTTGGCTGC
HKR218209 ARiS045I17 pGCAP10 NM_001030.4  
GCCTTTTCCGGCGGTGACNACCTACCCACACGAAAACATGCCTCTNGCAAAGGATCTCCT
HKR219652 ARiS049C04 pGCAP10 NM_001030.4  
CCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR234229 ARiS085J13 pGCAP10 NM_001030.4  
GCCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR235238 ARiS088B14 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR238514 ARiS096E18 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR238634 ARiS096J18 pGCAP10 NM_001030.4  
GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR238743 ARiS096O07 pGCAP10 NM_001030.4  
GCCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR247259 ARiS118C11 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR247517 ARiS118N05 pGCAP10 NM_001030.4  
GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR249112 ARiS122M24 pGCAP10 NM_001030.4  
GTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTCA
HKR264614 ARiS161I22 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR276424 ARiS191A24 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR276427 ARiS191B03 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR276588 ARiS191H20 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR276737 ARiS191O01 pGCAP10 NM_001030.4  
GCTTTTTTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATC
HKR277643 ARiS194B19 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR277734 ARiS194F14 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR320401 RBb01A01 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR320878 RBb02D06 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR321732 RBb04F12 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR321756 RBb04G12 pKA1U5 NM_001030.4  
GCCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR322429 RBb06B05 pKA1U5 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR322828 RBb07B04 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR322921 RBb07F01 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACNTGCCTCTCGCAAAGGATCTCCTT
HKR324075 RBb10D03 pKA1U5 NM_001030.4  
GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR324127 RBb10F07 pKA1U5 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR324859 RBb12C11 pKA1U5 NM_001030.4  
ATCCTGGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGAT
HKR325729 RBb14F09 pKA1U5 NM_001030.4  
GCCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR326482 RBb16D10 pKA1U5 NM_001030.4  
ATCCTGGGCTCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAG
HKR326806 RBb17A06 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR326969 RBb17H01 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR328081 RBb20D09 pKA1U5 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR329698 RBb24E02 pGCAP1 NM_001030.4  
GCTTTCCGGCGGGTGACGACCTACGCCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR330178 RBb25H10 pGCAP1 NM_001030.4  
GTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTCATC
HKR330831 RBb27B07 pGCAP1 NM_001030.4  
GGCGCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
HKR331750 RBb29G06 pGCAP1 NM_001030.4  
GTTCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
HKR333321 RBb33F01 pGCAP1 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTTNGCAAAGGATCTCCT
HKR334084 RBb35D12 pGCAP1 NM_001030.4  
TGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR336451 RBb41C03 pGCAP1 NM_001030.4  
CCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR336453 RBb41C05 pGCAP1 NM_001030.4  
CCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR336873 RBb42D01 pGCAP1 NM_001030.4  
GTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTCATC
HKR338099 RBb45E03 pGCAP1 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR338855 RBb47C07 pGCAP1 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR339202 RBb48A02 pGCAP1 NM_001030.4  
AGGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
HKR340856 RBb52C08 pGCAP1 NM_001030.4  
GCCTTTCCGGCGGGTGACGACCTACGCACACGTAGAACATGCCTCTCGCAAAGGATCTCC
HKR341606 RBb54A06 pGCAP1 NM_001030.4  
TGGCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
HKR342146 RBb55G02 pGCAP1 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGTAACATGCCTCTTCGCAAAGGATCTCCT
HKR343260 RBb58C12 pGCAP1 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTTCGCAAAGGATCTCCT
HKR343681 RBb59D09 pGCAP1 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR346050 RBb65C02 pGCAP1 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR347601 RBb69A01 pGCAP1 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR360409 RBd01A09 pGCAP10 NM_001030.4  
HKR361680 RBd04D08 pGCAP10 NM_001030.4  
CGGCCGGCCGATGCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCA
HKR362006 RBd05A06 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR362530 RBd06F10 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR362881 RBd07D09 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR362928 RBd07F08 pGCAP10 NM_001030.4  
GGCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR362947 RBd07G03 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR363278 RBd08D06 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACCACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR363279 RBd08D07 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR364026 RBd10B02 pGCAP10 NM_001030.4  
GCCTTTCCCCTGGCGACGACCTACACGGAAGAGAACGTGCCTCTCGCAAAGGATCACCTT
HKR364073 RBd10D01 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR365234 RBd13B10 pGCAP10 NM_001030.4  
GCCTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR365284 RBd13D12 pGCAP10 NM_001030.4  
TGGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
HKR365625 RBd14B01 pGCAP10 NM_001030.4  
GTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR365779 RBd14H11 pGCAP10 NM_001030.4  
HKR366153 RBd15G09 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR367658 RBd19C10 pGCAP10 NM_001030.4  
GCCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR369257 RBd23C09 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR369684 RBd24D12 pGCAP10 NM_001030.4  
GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR370505 RBd26E09 pGCAP10 NM_001030.4  
GTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR370980 RBd27H12 pGCAP10 NM_001030.4  
CGGCCGGCCGATGCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAA
HKR371630 RBd29B06 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR371775 RBd29H07 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR372073 RBd30D01 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR373376 RBd33H08 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR373377 RBd33H09 pGCAP10 NM_001030.4  
GAGGGGAGACGCTGAGGGCGGAGGGGGCGAGCGGGACCCCGAGTCCGGAGAAAGGCCCGG
HKR373778 RBd34H10 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR374169 RBd35H01 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR374546 RBd36G02 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR374808 RBd37A08 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR374905 RBd37E09 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR376477 RBd41D05 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR378406 RBd46A06 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR378412 RBd46A12 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR382101 RBd55E05 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCNNAAAGGATCTCCTT
HKR382151 RBd55G07 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCNGNNNGTGCTTTGGTCCAG
HKR382175 RBd55H07 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCNNNNAAAGGATCTCCTT
HKR384812 RBd62A12 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTNGGNNACNGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR386170 RBd65H02 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR386573 RBd66H05 pGCAP10 NM_001030.4  
GCCTTTCCGGNGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR387322 RBd68F02 pGCAP10 NM_001030.4  
GGCNCCNTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTC
HKR388101 RBd70E05 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR388530 RBd71F10 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR392475 RBd81D03 pGCAP10 NM_001030.4 done
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR392907 RBd82E11 pGCAP10 NM_001030.4  
TGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR393206 RBd83A06 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR393346 RBd83G02 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR393752 RBd84G08 pGCAP10 NM_001030.4  
GCCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR394507 RBd86E11 pGCAP10 NM_001030.4  
AGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR397255 RBd93C07 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR397631 RBd94B07 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR397684 RBd94D12 pGCAP10 NM_001030.4  
CGGCCGGCCGATGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCA
HKR398028 RBd95B04 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR398059 RBd95C11 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR398406 RBd96A06 pGCAP10 NM_001030.4  
GGCTTTCGCTCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAG
HKR399708 RBd99E12 pGCAP10 NM_001030.4  
GCCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR402817 RBdS007A17 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR402833 RBdS007B09 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR405616 RBdS014A16 pGCAP10 NM_001030.4  
GCCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR405655 RBdS014C07 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR406007 RBdS015A07 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR406014 RBdS015A14 pGCAP10 NM_001030.4  
GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR406066 RBdS015C18 pGCAP10 NM_001030.4  
GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR406088 RBdS015D16 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR406303 RBdS015M15 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR409123 RBdS022N11 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR416088 RBdS040D16 pGCAP10 NM_001030.4  
GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR416155 RBdS040G11 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR428192 RBdS070H24 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR430091 RBdS075D19 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR430166 RBdS075G22 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR430273 RBdS075L09 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR430347 RBdS075O11 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR433261 RBdS083C13 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR433438 RBdS083J22 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR433541 RBdS083O05 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR441641 RBdS104B17 pGCAP10 NM_001030.4  
GTTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR441646 RBdS104B22 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR441811 RBdS104I19 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR441861 RBdS104K21 pGCAP10 NM_001030.4  
GCTTTTTTCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGA
HKR442210 RBdS105I18 pGCAP10 NM_001030.4  
GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR444066 RBdS110C18 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR444160 RBdS110G16 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR444201 RBdS110I09 pGCAP10 NM_001030.4  
GCCTTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
HKR444326 RBdS110N14 pGCAP10 NM_001030.4  
GCTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCNNAGGATCTCCTT
HKR453130 RBdS132N18 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR453134 RBdS132N22 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR461762 RBdS154G18 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR462434 RBdS156B10 pGCAP10 NM_001030.4  
GCCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCT
HKR462533 RBdS156F13 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR462742 RBdS156O06 pGCAP10 NM_001030.4  
TGGCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCC
HKR470927 RBdS177F07 pGCAP10 NM_001030.4  
GCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR470963 RBdS177G19 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
HKR474982 RBdS187H14 pGCAP10 NM_001030.4  
GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl