Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022N11

Clone ID RBdS022N11
HP ID HP00469
Gene ID 6232
Gene Symbol RPS27
Protein Name ribosomal protein S27
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001030.4
Length of RefSeq (bp) 361
Chromosome 1q21
Reference DDBJ accession
UniGene Hs.546291
5'-terminal sequence GCCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTT
2011.08.28