Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00460

HP ID(1) HP00460
Gene ID(2) 6158
Gene Symbol finder RPL28
Protein Name ribosomal protein L28
RefSeq NM_000991.4
Length of RefSeq (bp) 4245
Chromosome 19q13.4
Reference DDBJ accession
UniGene Hs.652114

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06F04 pKA1U5 CTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAA
ARe07E04 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGNTCTGCGCATCTGC
ARe08F11 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARe17E12 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARe21F09 pKA1U5 GCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAAT
ARe25C09 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARe28E02 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARe32F12 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARe40C02 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARe42F01 pKA1U5 CTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAA
ARe44C04 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARe44E06 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARe46E03 pKA1U5 CTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAA
ARe48D11 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARe55F03 pKA1U5 ATCCTGGCTCTTTCCGTCTCAGGTCGCCGCTGCNAANGGAGCCGCCGCCATGTCTGCGCA
ARe64C10 pKA1U5 GCTTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAA
ARe67D05 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARe67F07 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARe68H12 pKA1U5 GCTCTTTCCGTCTCAGGGTCGCCGCTGCGAAGGGATNCGCCGCCATGTCTGCGCATCTGC
ARe69C10 pKA1U5 GCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAAT
ARe69F11 pKA1U5 GCTTTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARe86A05 pKA1U5 GCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAAT
ARe88B09 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARe94F01 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARf04A05 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARi06E05 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARi07F04 pGCAP10 NGCTCTTNCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGC
ARi08G12 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARi10F06 pGCAP10 CGGCCGGCCGATGCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTC
ARi29D10 pGCAP10 GTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAA
ARi30A08 pGCAP10 TGCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGC
ARi42E12 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARi53B10 pGCAP10 GNTCTTTCGGGACCCCGTCCTGGGGNNNAANGNANCCGCCGCCATGTCTGCCCATCTGCA
ARi69D08 pGCAP10 TTTTTTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGC
ARi70H05 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARiS008E02 pGCAP10 GCTCTTTCCGTCTCAAGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARiS013A11 pGCAP10 GCTTTTTCCGTCTCANGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARiS023P05 pGCAP10 GCTCTTTCCNTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARiS045I03 pGCAP10 GCTCTTTCCGTCTCANGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARiS045L15 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARiS055K17 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARiS087C16 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARiS087E12 pGCAP10 TGCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGC
ARiS087E22 pGCAP10
ARiS087J07 pGCAP10 GCTCTTTCCGTCTCANGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARiS087K01 pGCAP10
ARiS087L14 pGCAP10 GCTTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAA
ARiS088A14 pGCAP10 TGGTGGCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCAT
ARiS118E03 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARiS122A12 pGCAP10 CTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAA
ARiS150B04 pGCAP10 GCTTTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARiS150H04 pGCAP10 TCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARiS161G14 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
ARiS191J17 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
RBb11A08 pKA1U5 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
RBb14G04 pKA1U5 GGTCTCAGGCTCGCCGCTGCGAAGGGAGCCGCCCCCTTTNTCTGCGCATCTGCAATGGAT
RBb18A06 pKA1U5 TGTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
RBb19E07 pKA1U5 GCCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGC
RBb69H10 pGCAP1 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
RBb71H03 pGCAP1 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
RBd29A03 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
RBd50A02 pGCAP10 TGCTCTTTCCGTCTCNNGTCGCCGCTGCGAGNNGCCGCCGCCATGTCTGCGCATCTGCAT
RBd50D08 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
RBd57E03 pGCAP10 CGGCCGGCCGATGCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTC
RBd66E05 pGCAP10 GGTCTCNGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAATGGATGG
RBd71A03 pGCAP10 TGCCTCGCCTTCCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCT
RBd90D10 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
RBd90G06 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCCCCATGTCTGCGCATCTGCA
RBdS013F13 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
RBdS132C01 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
RBdS132F22 pGCAP10 GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl