Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS132C01

Clone ID RBdS132C01
HP ID HP00460
Gene ID 6158
Gene Symbol RPL28
Protein Name ribosomal protein L28
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000991.4
Length of RefSeq (bp) 4245
Chromosome 19q13.4
Reference DDBJ accession
UniGene Hs.652114
5'-terminal sequence GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
2011.08.28