Prev. |  KEGG KO K02903 > 

RIKEN DNA Bank Human Resource - RPL28

Gene ID NCBI Gene 6158 |  KEGG hsa:6158
Gene Symbol RPL28
Protein Name ribosomal protein L28
Synonyms L28
Ortholog resources KEGG ortholog (KEGG orthology K02903) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091479 IRAL028L15 pOTB7 BC010182 NM_000991 Full/var
HGY091715 IRAL029E19 pOTB7 BC011582 NM_000991 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042524 ARe06F04 pKA1U5 NM_000991.4  
CTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAA
HKR042900 ARe07E04 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGNTCTGCGCATCTGC
HKR043331 ARe08F11 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR046908 ARe17E12 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR048529 ARe21F09 pKA1U5 NM_000991.4  
GCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAAT
HKR050057 ARe25C09 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR051298 ARe28E02 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR052932 ARe32F12 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR056050 ARe40C02 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR056921 ARe42F01 pKA1U5 NM_000991.4  
CTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAA
HKR057652 ARe44C04 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR057702 ARe44E06 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR058499 ARe46E03 pKA1U5 NM_000991.4  
CTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAA
HKR059283 ARe48D11 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR062123 ARe55F03 pKA1U5 NM_000991.4  
ATCCTGGCTCTTTCCGTCTCAGGTCGCCGCTGCNAANGGAGCCGCCGCCATGTCTGCGCA
HKR065658 ARe64C10 pKA1U5 NM_000991.4  
GCTTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAA
HKR066877 ARe67D05 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR066927 ARe67F07 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR067380 ARe68H12 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGGTCGCCGCTGCGAAGGGATNCGCCGCCATGTCTGCGCATCTGC
HKR067658 ARe69C10 pKA1U5 NM_000991.4  
GCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAAT
HKR067731 ARe69F11 pKA1U5 NM_000991.4  
GCTTTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR074405 ARe86A05 pKA1U5 NM_000991.4  
GCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAAT
HKR075233 ARe88B09 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR077721 ARe94F01 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR081605 ARf04A05 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR162501 ARi06E05 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR162924 ARi07F04 pGCAP10 NM_000991.4  
NGCTCTTNCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGC
HKR163356 ARi08G12 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR164126 ARi10F06 pGCAP10 NM_000991.4  
CGGCCGGCCGATGCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTC
HKR171682 ARi29D10 pGCAP10 NM_000991.4  
GTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAA
HKR172008 ARi30A08 pGCAP10 NM_000991.4  
TGCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGC
HKR176908 ARi42E12 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR181234 ARi53B10 pGCAP10 NM_000991.4  
GNTCTTTCGGGACCCCGTCCTGGGGNNNAANGNANCCGCCGCCATGTCTGCCCATCTGCA
HKR187680 ARi69D08 pGCAP10 NM_000991.4  
TTTTTTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGC
HKR188173 ARi70H05 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR203298 ARiS008E02 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAAGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR205211 ARiS013A11 pGCAP10 NM_000991.4  
GCTTTTTCCGTCTCANGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR209565 ARiS023P05 pGCAP10 NM_000991.4  
GCTCTTTCCNTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR218195 ARiS045I03 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCANGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR218279 ARiS045L15 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR222257 ARiS055K17 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR234864 ARiS087C16 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR234908 ARiS087E12 pGCAP10 NM_000991.4  
TGCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGC
HKR234918 ARiS087E22 pGCAP10 NM_000991.4  
HKR235023 ARiS087J07 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCANGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR235041 ARiS087K01 pGCAP10 NM_000991.4  
HKR235078 ARiS087L14 pGCAP10 NM_000991.4  
GCTTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAA
HKR235214 ARiS088A14 pGCAP10 NM_000991.4  
TGGTGGCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCAT
HKR247299 ARiS118E03 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR248812 ARiS122A12 pGCAP10 NM_000991.4  
CTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAA
HKR260028 ARiS150B04 pGCAP10 NM_000991.4  
GCTTTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR260172 ARiS150H04 pGCAP10 NM_000991.4  
TCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR264558 ARiS161G14 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR276633 ARiS191J17 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR324408 RBb11A08 pKA1U5 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR325748 RBb14G04 pKA1U5 NM_000991.4  
GGTCTCAGGCTCGCCGCTGCGAAGGGAGCCGCCCCCTTTNTCTGCGCATCTGCAATGGAT
HKR327206 RBb18A06 pKA1U5 NM_000991.4  
TGTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR327703 RBb19E07 pKA1U5 NM_000991.4  
GCCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGC
HKR347778 RBb69H10 pGCAP1 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR348571 RBb71H03 pGCAP1 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR371603 RBd29A03 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR380002 RBd50A02 pGCAP10 NM_000991.4  
TGCTCTTTCCGTCTCNNGTCGCCGCTGCGAGNNGCCGCCGCCATGTCTGCGCATCTGCAT
HKR380080 RBd50D08 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR382899 RBd57E03 pGCAP10 NM_000991.4  
CGGCCGGCCGATGCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTC
HKR386501 RBd66E05 pGCAP10 NM_000991.4  
GGTCTCNGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCAATGGATGG
HKR388403 RBd71A03 pGCAP10 NM_000991.4  
TGCCTCGCCTTCCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCT
HKR396082 RBd90D10 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR396150 RBd90G06 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCCCCATGTCTGCGCATCTGCA
HKR405333 RBdS013F13 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR452849 RBdS132C01 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA
HKR452942 RBdS132F22 pGCAP10 NM_000991.4  
GCTCTTTCCGTCTCAGGTCGCCGCTGCGAAGGGAGCCGCCGCCATGTCTGCGCATCTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl