Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00438

HP ID(1) HP00438
Gene ID(2) 6136
Gene Symbol finder RPL12
Protein Name ribosomal protein L12
RefSeq NM_000976.2
Length of RefSeq (bp) 632
Chromosome 9q34
Reference DDBJ accession
UniGene Hs.408054

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04E03 pKA1U5 CTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCG
ARe04H11 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARe05C11 pKA1U5 ACGCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAAT
ARe06D08 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGCTGCAACTTCCTTCGGTCGTCCCGAATC
ARe06H12 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARe08H08 pKA1U5 CTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCG
ARe13C05 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARe15A09 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARe15B09 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARe19C02 pKA1U5 ATGCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAAT
ARe20B08 pKA1U5 GTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCG
ARe27G02 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARe34C10 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARe41C08 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARe59F02 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARe61B12 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGNGCAACTTCCTTCGGTCGTCCCGAATCC
ARe67D11 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARe68E07 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGCTGCAACTTCCTTCGGTCGTCCCGAATC
ARe75A04 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGCTGCAACTTCCTTCGGTCGTCCCGAATC
ARe80D11 pKA1U5 GCTCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAAT
ARf07G08 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARi13G10 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARi21B03 pGCAP10 GCTCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAAT
ARi34C09 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARi38C01 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARi39C12 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARi43F12 pGCAP10 TGCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATC
ARi46C10 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARi47D07 pGCAP10 CTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCG
ARi48D12 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARi50H02 pGCAP10 CTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCG
ARi54F02 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARi56H07 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARi58D06 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARi66B10 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARi68A03 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARi69E09 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARi70C07 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARiS008E11 pGCAP10 GCTCTCTCGGCTTNCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAAT
ARiS020I12 pGCAP10 GCTCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAAT
ARiS023I20 pGCAP10 GGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCGGGTTC
ARiS088J06 pGCAP10 TGCCCAGATTGAGGTGGTGCCTTCTGCCTCTGCCCTGATCATCAAAGCCCTCAAGGAACC
ARiS096A17 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARiS096K08 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGANGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARiS096O15 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARiS122A23 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARiS150E09 pGCAP10 GCTCTCGGCTTTCGGCTCNGANGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARiS161J05 pGCAP10 CTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCG
ARiS194G19 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
ARiS198D13 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBb02A04 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBb08A06 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBb18C10 pKA1U5 GGCAACTTCCTTCGGTCGTCCCGAATCCGGGTTCATCCGACACCAGCCGCCTCCACCATG
RBb20A08 pKA1U5 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBb61G10 pGCAP1 AAATGTGCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCC
RBb70C01 pGCAP1 CTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCG
RBd06F03 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBd08G11 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBd09D04 pGCAP10 AATGTTGATGGCCGCCATCCTCATGACATCATCGATGACATCAACAGTGGTGCTGTGGAA
RBd10A04 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBd11F07 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBd16H06 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBd22B05 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBd38C08 pGCAP10 GAGTCGGACGGGCGGTGNGACTCTTCTGGAAGGAACGCCGCGATGGCTGCGCANGGACAG
RBd57B06 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTNNNNTCGTCCCGAATCC
RBd58F07 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCNGTCGTCCCGAATCC
RBdS013L15 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBdS014L10 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBdS015I11 pGCAP10 GCTCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAAT
RBdS022B16 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBdS022O04 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBdS051J18 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBdS070D06 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBdS070D17 pGCAP10 GNTTTCNGNTTTNNNCTNGAATGAGGCCNNGGTGCNNGTTNCTTCNGNCGTCCNNAATCC
RBdS070O04 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBdS081I03 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBdS081K19 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBdS083B03 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBdS105H19 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBdS132M03 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
RBdS156C13 pGCAP10 GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl