Prev. |  KEGG KO K02870 > 

RIKEN DNA Bank Human Resource - RPL12

Gene ID NCBI Gene 6136 |  KEGG hsa:6136
Gene Symbol RPL12
Protein Name ribosomal protein L12
Synonyms L12
Ortholog resources KEGG ortholog (KEGG orthology K02870) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX044040 IRAK110B16 pCMV-SPORT6 BC050644 NM_000976 Full
HGX053609 IRAK134A09 pCMV-SPORT6 BC059950 NM_000976 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE013371 W01A033H03 pENTR-TOPO IRAK110B16 BC050644 NM_000976  
HGE013373 W01A033H05 pENTR-TOPO IRAK110B16 BC050644 NM_000976  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041699 ARe04E03 pKA1U5 NM_000976.2  
CTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCG
HKR041779 ARe04H11 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR042059 ARe05C11 pKA1U5 NM_000976.2  
ACGCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAAT
HKR042480 ARe06D08 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGCTGCAACTTCCTTCGGTCGTCCCGAATC
HKR042580 ARe06H12 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR043376 ARe08H08 pKA1U5 NM_000976.2  
CTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCG
HKR045253 ARe13C05 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR046009 ARe15A09 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR046033 ARe15B09 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR047650 ARe19C02 pKA1U5 NM_000976.2  
ATGCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAAT
HKR048032 ARe20B08 pKA1U5 NM_000976.2  
GTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCG
HKR050946 ARe27G02 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR053658 ARe34C10 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR056456 ARe41C08 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR063722 ARe59F02 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR064436 ARe61B12 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGNGCAACTTCCTTCGGTCGTCCCGAATCC
HKR066883 ARe67D11 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR067303 ARe68E07 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGCTGCAACTTCCTTCGGTCGTCCCGAATC
HKR070004 ARe75A04 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGCTGCAACTTCCTTCGGTCGTCCCGAATC
HKR072083 ARe80D11 pKA1U5 NM_000976.2  
GCTCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAAT
HKR082952 ARf07G08 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR165354 ARi13G10 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR168427 ARi21B03 pGCAP10 NM_000976.2  
GCTCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAAT
HKR173657 ARi34C09 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR175249 ARi38C01 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR175660 ARi39C12 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR177332 ARi43F12 pGCAP10 NM_000976.2  
TGCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATC
HKR178458 ARi46C10 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR178879 ARi47D07 pGCAP10 NM_000976.2  
CTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCG
HKR179284 ARi48D12 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR180170 ARi50H02 pGCAP10 NM_000976.2  
CTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCG
HKR181722 ARi54F02 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR182575 ARi56H07 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR183278 ARi58D06 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR186434 ARi66B10 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR187203 ARi68A03 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR187705 ARi69E09 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR188055 ARi70C07 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR203307 ARiS008E11 pGCAP10 NM_000976.2  
GCTCTCTCGGCTTNCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAAT
HKR208204 ARiS020I12 pGCAP10 NM_000976.2  
GCTCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAAT
HKR209412 ARiS023I20 pGCAP10 NM_000976.2  
GGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCGGGTTC
HKR235422 ARiS088J06 pGCAP10 NM_000976.2  
TGCCCAGATTGAGGTGGTGCCTTCTGCCTCTGCCCTGATCATCAAAGCCCTCAAGGAACC
HKR238417 ARiS096A17 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR238648 ARiS096K08 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGANGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR238751 ARiS096O15 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR248823 ARiS122A23 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR260105 ARiS150E09 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCNGANGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR264621 ARiS161J05 pGCAP10 NM_000976.2  
CTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCG
HKR277763 ARiS194G19 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR279285 ARiS198D13 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR320804 RBb02A04 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR323206 RBb08A06 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR327258 RBb18C10 pKA1U5 NM_000976.2  
GGCAACTTCCTTCGGTCGTCCCGAATCCGGGTTCATCCGACACCAGCCGCCTCCACCATG
HKR328008 RBb20A08 pKA1U5 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR344554 RBb61G10 pGCAP1 NM_000976.2  
AAATGTGCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCC
HKR348049 RBb70C01 pGCAP1 NM_000976.2  
CTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCCG
HKR362523 RBd06F03 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR363355 RBd08G11 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR363676 RBd09D04 pGCAP10 NM_000976.2  
AATGTTGATGGCCGCCATCCTCATGACATCATCGATGACATCAACAGTGGTGCTGTGGAA
HKR364004 RBd10A04 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR364527 RBd11F07 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR366574 RBd16H06 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR368829 RBd22B05 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR375256 RBd38C08 pGCAP10 NM_000976.2  
GAGTCGGACGGGCGGTGNGACTCTTCTGGAAGGAACGCCGCGATGGCTGCGCANGGACAG
HKR382830 RBd57B06 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTNNNNTCGTCCCGAATCC
HKR383327 RBd58F07 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCNGTCGTCCCGAATCC
HKR405479 RBdS013L15 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR405874 RBdS014L10 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR406203 RBdS015I11 pGCAP10 NM_000976.2  
GCTCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAAT
HKR408840 RBdS022B16 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR409140 RBdS022O04 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR420634 RBdS051J18 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR428078 RBdS070D06 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR428089 RBdS070D17 pGCAP10 NM_000976.2  
GNTTTCNGNTTTNNNCTNGAATGAGGCCNNGGTGCNNGTTNCTTCNGNCGTCCNNAATCC
HKR428340 RBdS070O04 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR432595 RBdS081I03 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR432659 RBdS081K19 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR433227 RBdS083B03 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR442187 RBdS105H19 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR453091 RBdS132M03 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
HKR462461 RBdS156C13 pGCAP10 NM_000976.2  
GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl