Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083B03

Clone ID RBdS083B03
HP ID HP00438
Gene ID 6136
Gene Symbol RPL12
Protein Name ribosomal protein L12
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000976.2
Length of RefSeq (bp) 632
Chromosome 9q34
Reference DDBJ accession
UniGene Hs.408054
5'-terminal sequence GCTCTCGGCTTTCGGCTCGGAGGAGGCCAAGGTGCAACTTCCTTCGGTCGTCCCGAATCC
2011.08.28