Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00419

HP ID(1) HP00419
Gene ID(2) 6203
Gene Symbol finder RPS9
Protein Name ribosomal protein S9
RefSeq NM_001013.3
Length of RefSeq (bp) 753
Chromosome 19q13.4
Reference DDBJ accession
UniGene Hs.546288

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe07F05 pKA1U5 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARe15C09 pKA1U5 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARe19A08 pKA1U5 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARe19E11 pKA1U5 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARe23H08 pKA1U5 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARe43D06 pKA1U5 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARe44D09 pKA1U5 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCNGACGGGGAAGCGGAGCCAACATG
ARe50B07 pKA1U5 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARe50B11 pKA1U5 GTCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACAT
ARe63E08 pKA1U5 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARe65H07 pKA1U5 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARe66D10 pKA1U5 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARe81C08 pKA1U5 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARe89H10 pKA1U5 GTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATGC
ARe97A03 pKA1U5 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARf01C01 pKA1U5 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARi05H11 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARi23G12 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGTGAGGCGCAGACGGGGAAGCGGAGCCA
ARi32H12 pGCAP10 GTCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACAT
ARi33H12 pGCAP10 TGTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARi40C05 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARi43A09 pGCAP10 CCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARi49C02 pGCAP10 GTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATGC
ARi62C11 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTNNNCGCAGACNGNAGCGGAGCNACATGNNN
ARi69D05 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARiS008J06 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARiS023E14 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARiS045E20 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARiS049H08 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARiS085C01 pGCAP10 TGGCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARiS085O14 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARiS109J24 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARiS109O01 pGCAP10 CGGCCGGCNNATGCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGC
ARiS118P14 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARiS161I01 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
ARiS194N23 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
RBb20G09 pKA1U5 ATCCTGGCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCC
RBb38D06 pGCAP1 CTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATGC
RBd01F04 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
RBd14D05 pGCAP10
RBd18C12 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
RBd49A11 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
RBd56B10 pGCAP10 GGCAGACGGGGAAGCGGAGCCAACATGCCAGTGGCCCGGAGCTGGGTTTGTCGCAAAACT
RBd64D07 pGCAP10 TGGCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGTGCGGTGCGGTGGTGTGCTTTTTCT
RBd88B07 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
RBd94E04 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
RBdS007P22 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
RBdS013P09 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
RBdS040N19 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
RBdS075A03 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
RBdS075A22 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
RBdS081C09 pGCAP10 GCTCTTTCTCANTGACCNGNTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
RBdS083J05 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
RBdS104J20 pGCAP10 GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl