Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075A03

Clone ID RBdS075A03
HP ID HP00419
Gene ID 6203
Gene Symbol RPS9
Protein Name ribosomal protein S9
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001013.3
Length of RefSeq (bp) 753
Chromosome 19q13.4
Reference DDBJ accession
UniGene Hs.546288
5'-terminal sequence GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
2011.08.28