Prev. |  KEGG KO K02997 > 

RIKEN DNA Bank Human Resource - RPS9

Gene ID NCBI Gene 6203 |  KEGG hsa:6203
Gene Symbol RPS9
Protein Name ribosomal protein S9
Synonyms S9
Ortholog resources KEGG ortholog (KEGG orthology K02997) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001849 IRAK004K09 pCMV-SPORT6 BC000802 NM_001013 Full
HGY081297 IRAL003E01 pOTB7 BC007410 NM_001013 Full
HGY084148 IRAL010G04 pOTB7 BC007434 NM_001013 Full
HGY088254 IRAL020K14 pOTB7 BC007857 NM_001013 Full
HGY103427 IRAL058J11 pOTB7 BC071940 NM_001013 Full
HGY103560 IRAL058O24 pOTB7 BC071941 NM_001013 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042925 ARe07F05 pKA1U5 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR046057 ARe15C09 pKA1U5 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR047608 ARe19A08 pKA1U5 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR047707 ARe19E11 pKA1U5 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR049376 ARe23H08 pKA1U5 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR057278 ARe43D06 pKA1U5 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR057681 ARe44D09 pKA1U5 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCNGACGGGGAAGCGGAGCCAACATG
HKR060031 ARe50B07 pKA1U5 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR060035 ARe50B11 pKA1U5 NM_001013.3  
GTCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACAT
HKR065304 ARe63E08 pKA1U5 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR066175 ARe65H07 pKA1U5 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR066482 ARe66D10 pKA1U5 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR072456 ARe81C08 pKA1U5 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR075778 ARe89H10 pKA1U5 NM_001013.3  
GTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATGC
HKR078803 ARe97A03 pKA1U5 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR080449 ARf01C01 pKA1U5 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR162179 ARi05H11 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR169356 ARi23G12 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGTGAGGCGCAGACGGGGAAGCGGAGCCA
HKR172980 ARi32H12 pGCAP10 NM_001013.3  
GTCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACAT
HKR173380 ARi33H12 pGCAP10 NM_001013.3  
TGTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR176053 ARi40C05 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR177209 ARi43A09 pGCAP10 NM_001013.3  
CCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR179650 ARi49C02 pGCAP10 NM_001013.3  
GTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATGC
HKR184859 ARi62C11 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTNNNCGCAGACNGNAGCGGAGCNACATGNNN
HKR187677 ARi69D05 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR203422 ARiS008J06 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR209310 ARiS023E14 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR218116 ARiS045E20 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR219776 ARiS049H08 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR234049 ARiS085C01 pGCAP10 NM_001013.3  
TGGCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR234350 ARiS085O14 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR243840 ARiS109J24 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR243937 ARiS109O01 pGCAP10 NM_001013.3  
CGGCCGGCNNATGCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGC
HKR247574 ARiS118P14 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR264593 ARiS161I01 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR277935 ARiS194N23 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR328153 RBb20G09 pKA1U5 NM_001013.3  
ATCCTGGCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCC
HKR335278 RBb38D06 pGCAP1 NM_001013.3  
CTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATGC
HKR360524 RBd01F04 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR365677 RBd14D05 pGCAP10 NM_001013.3  
HKR367260 RBd18C12 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR379611 RBd49A11 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR382434 RBd56B10 pGCAP10 NM_001013.3  
GGCAGACGGGGAAGCGGAGCCAACATGCCAGTGGCCCGGAGCTGGGTTTGTCGCAAAACT
HKR385679 RBd64D07 pGCAP10 NM_001013.3  
TGGCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGTGCGGTGCGGTGGTGTGCTTTTTCT
HKR395231 RBd88B07 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR397700 RBd94E04 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR403182 RBdS007P22 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR405569 RBdS013P09 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR416331 RBdS040N19 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR430003 RBdS075A03 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR430022 RBdS075A22 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR432457 RBdS081C09 pGCAP10 NM_001013.3  
GCTCTTTCTCANTGACCNGNTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR433421 RBdS083J05 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG
HKR441836 RBdS104J20 pGCAP10 NM_001013.3  
GCTCTTTCTCAGTGACCGGGTGGTTTGCTTAGGCGCAGACGGGGAAGCGGAGCCAACATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl