Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00415

HP ID(1) HP00415
Gene ID(2) 6156
Gene Symbol finder RPL30
Protein Name ribosomal protein L30
RefSeq NM_000989.2
Length of RefSeq (bp) 524
Chromosome 8q22
Reference DDBJ accession
UniGene Hs.400295

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe17H06 pKA1U5 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARe23D06 pKA1U5 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARe23E12 pKA1U5 GCCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
ARe27F02 pKA1U5 GCCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
ARe35A11 pKA1U5 CCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTTGGTTGGGGGCCGTCCCGCTCCT
ARe35D09 pKA1U5 GCCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGATTGGTTGGGGGCCGTCCCGCTC
ARe60B05 pKA1U5 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARe70C09 pKA1U5 TTGCTTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTC
ARe83B04 pKA1U5 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARe87D05 pKA1U5 ATCCTGGCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
ARe89G11 pKA1U5 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARe90G03 pKA1U5 TGGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAGGCAGGAAGATGGTGGCCGCAAAG
ARf01C03 pKA1U5 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARf06H03 pKA1U5 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARi12D07 pGCAP10 TGCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
ARi22F03 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARi27F06 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARi29F04 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARi30B08 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARi55D03 pGCAP10 TGGGCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTC
ARi56C08 pGCAP10 GCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAGGCAGGAAG
ARi59B05 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARiS045D11 pGCAP10 ATCTTAGCNNCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAGGCAGGAAGATGGTGGCC
ARiS055D07 pGCAP10 GCCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGNNTCNNTNTCCT
ARiS055F23 pGCAP10 GCCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
ARiS087H07 pGCAP10 TTGTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARiS087K20 pGCAP10 TTTTCGCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCG
ARiS088J09 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARiS122N08 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
ARiS191D10 pGCAP10 GATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAGGCAGGAAGATGGTGGC
ARiS194E07 pGCAP10 GCTTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGC
ARiS194K08 pGCAP10 GCTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAG
ARiS194N22 pGCAP10 GCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTA
ARiS198F12 pGCAP10 GACTGGTGAAAAGTAAACCTTTTCACCTACAAAATTTCACCTGCAAACCTTAAACCTGCA
RBb04A12 pKA1U5 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBb05B11 pKA1U5 GCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAGGC
RBb16E12 pKA1U5 TGCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
RBb20H12 pKA1U5 GCCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
RBb21H10 pKA1U5 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBb37E06 pGCAP1 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBb57C08 pGCAP1 GTCCCGCTCCTAAGGCAGGAAGATGGTGGCCGCAAAGAAGACGAAAAAGTCGCTGGAGTC
RBb61G06 pGCAP1 CCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTA
RBd04E03 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBd19E01 pGCAP10 GCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTA
RBd20C03 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBd27H02 pGCAP10 GCTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAG
RBd31F05 pGCAP10
RBd51E10 pGCAP10 GGTCTTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCC
RBd59D11 pGCAP10 TGCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
RBd61G09 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBd66C11 pGCAP10 GCCNNNNTNGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBd70B05 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBd74B06 pGCAP10 CGGCCGGCCGATGCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGC
RBd75D04 pGCAP10 GCCCTTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTC
RBd78C02 pGCAP10 GCCTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGC
RBd90G03 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBd97D01 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBdS007H23 pGCAP10 TGCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAGGCAGGAA
RBdS007L02 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBdS007N19 pGCAP10 GCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTA
RBdS014K01 pGCAP10 GCTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAG
RBdS015F09 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBdS015J08 pGCAP10 GCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTA
RBdS022K14 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBdS022M02 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBdS040F05 pGCAP10 GGCTGTTGGTGAGTGGGCTCCTACCGACCGAGGTTTAGGCAGCGCGGGGAGCTTTGCGGG
RBdS040H07 pGCAP10 ATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAGGCAGGAAGATGGTGGCC
RBdS040J21 pGCAP10 GGGAAGTCTTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCG
RBdS081H05 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBdS081O17 pGCAP10 GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
RBdS083E23 pGCAP10 GCCTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGC
RBdS104B23 pGCAP10 GCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTA
RBdS105L22 pGCAP10 GCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTA
RBdS154D19 pGCAP10 GGTCTTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCC
RBdS177J12 pGCAP10 TGCTTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl