Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081H05

Clone ID RBdS081H05
HP ID HP00415
Gene ID 6156
Gene Symbol RPL30
Protein Name ribosomal protein L30
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000989.2
Length of RefSeq (bp) 524
Chromosome 8q22
Reference DDBJ accession
UniGene Hs.400295
5'-terminal sequence GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
2011.08.28