Prev. |  KEGG KO K02908 > 

RIKEN DNA Bank Human Resource - RPL30

Gene ID NCBI Gene 6156 |  KEGG hsa:6156
Gene Symbol RPL30
Protein Name ribosomal protein L30
Synonyms L30
Ortholog resources KEGG ortholog (KEGG orthology K02908) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027686 IRAK069D14 pCMV-SPORT6 BC032700 NM_000989 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046974 ARe17H06 pKA1U5 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR049278 ARe23D06 pKA1U5 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR049308 ARe23E12 pKA1U5 NM_000989.2  
GCCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
HKR050922 ARe27F02 pKA1U5 NM_000989.2  
GCCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
HKR054011 ARe35A11 pKA1U5 NM_000989.2  
CCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTTGGTTGGGGGCCGTCCCGCTCCT
HKR054081 ARe35D09 pKA1U5 NM_000989.2  
GCCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGATTGGTTGGGGGCCGTCCCGCTC
HKR064029 ARe60B05 pKA1U5 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR068057 ARe70C09 pKA1U5 NM_000989.2  
TTGCTTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTC
HKR073228 ARe83B04 pKA1U5 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR074877 ARe87D05 pKA1U5 NM_000989.2  
ATCCTGGCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
HKR075755 ARe89G11 pKA1U5 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR076147 ARe90G03 pKA1U5 NM_000989.2  
TGGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAGGCAGGAAGATGGTGGCCGCAAAG
HKR080451 ARf01C03 pKA1U5 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR082571 ARf06H03 pKA1U5 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR164879 ARi12D07 pGCAP10 NM_000989.2  
TGCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
HKR168923 ARi22F03 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR170926 ARi27F06 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR171724 ARi29F04 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR172032 ARi30B08 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR182075 ARi55D03 pGCAP10 NM_000989.2  
TGGGCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTC
HKR182456 ARi56C08 pGCAP10 NM_000989.2  
GCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAGGCAGGAAG
HKR183629 ARi59B05 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR218083 ARiS045D11 pGCAP10 NM_000989.2  
ATCTTAGCNNCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAGGCAGGAAGATGGTGGCC
HKR222079 ARiS055D07 pGCAP10 NM_000989.2  
GCCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGNNTCNNTNTCCT
HKR222143 ARiS055F23 pGCAP10 NM_000989.2  
GCCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
HKR234975 ARiS087H07 pGCAP10 NM_000989.2  
TTGTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR235060 ARiS087K20 pGCAP10 NM_000989.2  
TTTTCGCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCG
HKR235425 ARiS088J09 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR249120 ARiS122N08 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR276482 ARiS191D10 pGCAP10 NM_000989.2  
GATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAGGCAGGAAGATGGTGGC
HKR277703 ARiS194E07 pGCAP10 NM_000989.2  
GCTTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGC
HKR277848 ARiS194K08 pGCAP10 NM_000989.2  
GCTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAG
HKR277934 ARiS194N22 pGCAP10 NM_000989.2  
GCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTA
HKR279332 ARiS198F12 pGCAP10 NM_000989.2  
GACTGGTGAAAAGTAAACCTTTTCACCTACAAAATTTCACCTGCAAACCTTAAACCTGCA
HKR321612 RBb04A12 pKA1U5 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR322035 RBb05B11 pKA1U5 NM_000989.2  
GCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAGGC
HKR326508 RBb16E12 pKA1U5 NM_000989.2  
TGCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
HKR328180 RBb20H12 pKA1U5 NM_000989.2  
GCCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
HKR328578 RBb21H10 pKA1U5 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR334902 RBb37E06 pGCAP1 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR342856 RBb57C08 pGCAP1 NM_000989.2  
GTCCCGCTCCTAAGGCAGGAAGATGGTGGCCGCAAAGAAGACGAAAAAGTCGCTGGAGTC
HKR344550 RBb61G06 pGCAP1 NM_000989.2  
CCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTA
HKR361699 RBd04E03 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR367697 RBd19E01 pGCAP10 NM_000989.2  
GCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTA
HKR368051 RBd20C03 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR370970 RBd27H02 pGCAP10 NM_000989.2  
GCTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAG
HKR372525 RBd31F05 pGCAP10 NM_000989.2  
HKR380506 RBd51E10 pGCAP10 NM_000989.2  
GGTCTTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCC
HKR383683 RBd59D11 pGCAP10 NM_000989.2  
TGCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCC
HKR384553 RBd61G09 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR386459 RBd66C11 pGCAP10 NM_000989.2  
GCCNNNNTNGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR388029 RBd70B05 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR389630 RBd74B06 pGCAP10 NM_000989.2  
CGGCCGGCCGATGCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGC
HKR390076 RBd75D04 pGCAP10 NM_000989.2  
GCCCTTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTC
HKR391250 RBd78C02 pGCAP10 NM_000989.2  
GCCTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGC
HKR396147 RBd90G03 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR398873 RBd97D01 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR402991 RBdS007H23 pGCAP10 NM_000989.2  
TGCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAGGCAGGAA
HKR403066 RBdS007L02 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR403131 RBdS007N19 pGCAP10 NM_000989.2  
GCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTA
HKR405841 RBdS014K01 pGCAP10 NM_000989.2  
GCTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAG
HKR406129 RBdS015F09 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR406224 RBdS015J08 pGCAP10 NM_000989.2  
GCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTA
HKR409054 RBdS022K14 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR409090 RBdS022M02 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR416125 RBdS040F05 pGCAP10 NM_000989.2  
GGCTGTTGGTGAGTGGGCTCCTACCGACCGAGGTTTAGGCAGCGCGGGGAGCTTTGCGGG
HKR416175 RBdS040H07 pGCAP10 NM_000989.2  
ATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTAAGGCAGGAAGATGGTGGCC
HKR416237 RBdS040J21 pGCAP10 NM_000989.2  
GGGAAGTCTTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCG
HKR432573 RBdS081H05 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR432753 RBdS081O17 pGCAP10 NM_000989.2  
GCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCT
HKR433319 RBdS083E23 pGCAP10 NM_000989.2  
GCCTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGC
HKR441647 RBdS104B23 pGCAP10 NM_000989.2  
GCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTA
HKR442286 RBdS105L22 pGCAP10 NM_000989.2  
GCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCTCCTA
HKR461691 RBdS154D19 pGCAP10 NM_000989.2  
GGTCTTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCC
HKR471028 RBdS177J12 pGCAP10 NM_000989.2  
TGCTTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl