Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00397

HP ID(1) HP00397
Gene ID(2) 6165
Gene Symbol finder RPL35A
Protein Name ribosomal protein L35a
RefSeq NM_000996.2
Length of RefSeq (bp) 511
Chromosome 3q29-qter
Reference DDBJ accession
UniGene Hs.529631

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe09E02 pKA1U5 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARe21D08 pKA1U5 GCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
ARe30H12 pKA1U5 TGGCCTCGTCCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGAC
ARe31D09 pKA1U5 GCCTGTGGAGGTGAGTGAAGGGTCTGCTGCTGAAATTTGGGGGCAAATAACCGGAGTAGG
ARe32C11 pKA1U5 GCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
ARe44A02 pKA1U5 CTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAAC
ARe51E01 pKA1U5 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARe61E05 pKA1U5 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCNGCTGGGAACGGGACTTCTAAAAGGAA
ARe79D12 pKA1U5 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARe79F09 pKA1U5 GTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGA
ARe80B05 pKA1U5 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARe80F02 pKA1U5 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARe92F01 pKA1U5 ATCCTGGCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAA
ARe95F03 pKA1U5 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARe98G05 pKA1U5 GGGGGCCTCGTCCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGG
ARf04G08 pKA1U5 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARi04H12 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARi07A06 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARi25G03 pGCAP10 GTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGA
ARi28D11 pGCAP10 GCCCCCGNCCGGCCCACCCCCTTTCCCCCCCCTTGCCTGCCGTCCAGGCCTGCGGGGAAC
ARi28D12 pGCAP10 CGGCCGGCCGATGCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGAC
ARi29B04 pGCAP10 GTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAAC
ARi61F12 pGCAP10 GCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
ARi63D11 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARi65G07 pGCAP10 CTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAAC
ARi71G02 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARiS008H02 pGCAP10 GCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
ARiS008I21 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARiS008J10 pGCAP10 GGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCTGGAAGGCTG
ARiS020G04 pGCAP10 GATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCTGGA
ARiS020H20 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARiS023P22 pGCAP10 GTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTAT
ARiS045L18 pGCAP10 TGCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAA
ARiS055M22 pGCAP10
ARiS055P22 pGCAP10 GGTCCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAA
ARiS085F07 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARiS088M23 pGCAP10 GACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATG
ARiS096D11 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARiS109B13 pGCAP10 GTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGA
ARiS118H02 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARiS122B19 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
ARiS150N03 pGCAP10 GCTTCTCTTACCGCCATCTTGNCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
ARiS191B06 pGCAP10 CGGCCGGCCGATGCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGAC
ARiS194M12 pGCAP10 CTCTTACCNCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAAC
RBb05C11 pKA1U5 GGTCCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAA
RBb06F01 pKA1U5 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGNTGGGAACGGGACTTCTAAAAGGAA
RBb08A03 pKA1U5 GCTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGG
RBb08A09 pKA1U5 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBb08C08 pKA1U5 TTGGGCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTA
RBb09F11 pKA1U5 TGGGTCCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCT
RBb10A06 pKA1U5 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBb21F01 pKA1U5 GAATCCCACAAGGCCACGCGGCGGGGCCTCGNTCCTTCTCTTACCGCCATCTTGGCTCCT
RBb21G08 pKA1U5 GTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGA
RBb27A05 pGCAP1 AAATGTGGCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTA
RBb43D04 pGCAP1 TGCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAANAGCG
RBb43G07 pGCAP1 GCTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGG
RBb45D10 pGCAP1 TGCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAA
RBb45D11 pGCAP1 TAATGGGAGTCGAAAGATGTTTAATCCCACAAGGCCACGCGGCGGGGCCTCGTCCTTCTC
RBb57G10 pGCAP1 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBb62G11 pGCAP1 TTGATCTTGGCTCCTGTGGAGGCCTGCTGGGACGGGACTTCTAAAGGACTATGTCTGGAA
RBb63C04 pGCAP1 ATGGATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCT
RBd02C07 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBd04H05 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBd08F05 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBd10A06 pGCAP10 GGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCT
RBd10B08 pGCAP10 GCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
RBd12F08 pGCAP10 GACCGCCATCTTGGCTCCTGTGGAGGCATGCTGGNNTNGNACTTCTACCCCNNACTATGT
RBd15B05 pGCAP10 TGGCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBd17B09 pGCAP10 GCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
RBd17G04 pGCAP10 GCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
RBd25B04 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBd29B02 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBd31G11 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBd33B06 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBd38D10 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBd45A11 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBd49D12 pGCAP10 CGGCCGGCCGATGTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGA
RBd53H01 pGCAP10 GAATTGCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAA
RBd64A03 pGCAP10 TGACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTAT
RBd66A10 pGCAP10 GCTCTTACCGCCATCTNGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAACGAN
RBd80F05 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBd84C01 pGCAP10 GACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATG
RBd92F08 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBd96A04 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBdS013O14 pGCAP10 TGCTCTTACCGCCATCTTGGCTCCTGTGGAGGTGAGTGAAGGGTCTGCTGCTGAAATTTG
RBdS014M22 pGCAP10 GGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCT
RBdS070H03 pGCAP10 GACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATG
RBdS075D15 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBdS081K01 pGCAP10 GATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCTGGA
RBdS083E24 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBdS132K21 pGCAP10 GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
RBdS154J15 pGCAP10 GACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATG
RBdS177P08 pGCAP10 GGAGTGAAGGGTCTGCTGCTGAAATTTGGGGGCAAATAACCGGAGTAGGTTTGTTCCTGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl