Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154J15

Clone ID RBdS154J15
HP ID HP00397
Gene ID 6165
Gene Symbol RPL35A
Protein Name ribosomal protein L35a
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000996.2
Length of RefSeq (bp) 511
Chromosome 3q29-qter
Reference DDBJ accession
UniGene Hs.529631
5'-terminal sequence GACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATG
2011.08.28