Prev. |  KEGG KO K02917 > 

RIKEN DNA Bank Human Resource - RPL35A

Gene ID NCBI Gene 6165 |  KEGG hsa:6165
Gene Symbol RPL35A
Protein Name ribosomal protein L35a
Synonyms DBA5|L35A|eL33
Ortholog resources KEGG ortholog (KEGG orthology K02917) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008376 IRAK020P16 pCMV-SPORT6 BC017093 NM_000996 Full
HGY081662 IRAL004C14 pOTB7 BC001037 NM_000996 Full
HGY087732 IRAL019F12 pDNR-LIB BC010949 NM_000996 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043698 ARe09E02 pKA1U5 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR048480 ARe21D08 pKA1U5 NM_000996.2  
GCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
HKR052180 ARe30H12 pKA1U5 NM_000996.2  
TGGCCTCGTCCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGAC
HKR052481 ARe31D09 pKA1U5 NM_000996.2  
GCCTGTGGAGGTGAGTGAAGGGTCTGCTGCTGAAATTTGGGGGCAAATAACCGGAGTAGG
HKR052859 ARe32C11 pKA1U5 NM_000996.2  
GCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
HKR057602 ARe44A02 pKA1U5 NM_000996.2  
CTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAAC
HKR060497 ARe51E01 pKA1U5 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR064501 ARe61E05 pKA1U5 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCNGCTGGGAACGGGACTTCTAAAAGGAA
HKR071684 ARe79D12 pKA1U5 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR071729 ARe79F09 pKA1U5 NM_000996.2  
GTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGA
HKR072029 ARe80B05 pKA1U5 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR072122 ARe80F02 pKA1U5 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR076921 ARe92F01 pKA1U5 NM_000996.2  
ATCCTGGCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAA
HKR078123 ARe95F03 pKA1U5 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR079349 ARe98G05 pKA1U5 NM_000996.2  
GGGGGCCTCGTCCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGG
HKR081752 ARf04G08 pKA1U5 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR161780 ARi04H12 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR162806 ARi07A06 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR170147 ARi25G03 pGCAP10 NM_000996.2  
GTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGA
HKR171283 ARi28D11 pGCAP10 NM_000996.2  
GCCCCCGNCCGGCCCACCCCCTTTCCCCCCCCTTGCCTGCCGTCCAGGCCTGCGGGGAAC
HKR171284 ARi28D12 pGCAP10 NM_000996.2  
CGGCCGGCCGATGCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGAC
HKR171628 ARi29B04 pGCAP10 NM_000996.2  
GTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAAC
HKR184532 ARi61F12 pGCAP10 NM_000996.2  
GCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
HKR185283 ARi63D11 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR186151 ARi65G07 pGCAP10 NM_000996.2  
CTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAAC
HKR188546 ARi71G02 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR203370 ARiS008H02 pGCAP10 NM_000996.2  
GCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
HKR203413 ARiS008I21 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR203426 ARiS008J10 pGCAP10 NM_000996.2  
GGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCTGGAAGGCTG
HKR208148 ARiS020G04 pGCAP10 NM_000996.2  
GATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCTGGA
HKR208188 ARiS020H20 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR209582 ARiS023P22 pGCAP10 NM_000996.2  
GTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTAT
HKR218282 ARiS045L18 pGCAP10 NM_000996.2  
TGCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAA
HKR222310 ARiS055M22 pGCAP10 NM_000996.2  
HKR222382 ARiS055P22 pGCAP10 NM_000996.2  
GGTCCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAA
HKR234127 ARiS085F07 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR235511 ARiS088M23 pGCAP10 NM_000996.2  
GACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATG
HKR238483 ARiS096D11 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR243637 ARiS109B13 pGCAP10 NM_000996.2  
GTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGA
HKR247370 ARiS118H02 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR248843 ARiS122B19 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR260315 ARiS150N03 pGCAP10 NM_000996.2  
GCTTCTCTTACCGCCATCTTGNCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
HKR276430 ARiS191B06 pGCAP10 NM_000996.2  
CGGCCGGCCGATGCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGAC
HKR277900 ARiS194M12 pGCAP10 NM_000996.2  
CTCTTACCNCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAAC
HKR322059 RBb05C11 pKA1U5 NM_000996.2  
GGTCCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAA
HKR322521 RBb06F01 pKA1U5 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGNTGGGAACGGGACTTCTAAAAGGAA
HKR323203 RBb08A03 pKA1U5 NM_000996.2  
GCTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGG
HKR323209 RBb08A09 pKA1U5 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR323256 RBb08C08 pKA1U5 NM_000996.2  
TTGGGCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTA
HKR323731 RBb09F11 pKA1U5 NM_000996.2  
TGGGTCCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCT
HKR324006 RBb10A06 pKA1U5 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR328521 RBb21F01 pKA1U5 NM_000996.2  
GAATCCCACAAGGCCACGCGGCGGGGCCTCGNTCCTTCTCTTACCGCCATCTTGGCTCCT
HKR328552 RBb21G08 pKA1U5 NM_000996.2  
GTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGA
HKR330805 RBb27A05 pGCAP1 NM_000996.2  
AAATGTGGCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTA
HKR337276 RBb43D04 pGCAP1 NM_000996.2  
TGCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAANAGCG
HKR337351 RBb43G07 pGCAP1 NM_000996.2  
GCTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGG
HKR338082 RBb45D10 pGCAP1 NM_000996.2  
TGCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAA
HKR338083 RBb45D11 pGCAP1 NM_000996.2  
TAATGGGAGTCGAAAGATGTTTAATCCCACAAGGCCACGCGGCGGGGCCTCGTCCTTCTC
HKR342954 RBb57G10 pGCAP1 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR344955 RBb62G11 pGCAP1 NM_000996.2  
TTGATCTTGGCTCCTGTGGAGGCCTGCTGGGACGGGACTTCTAAAGGACTATGTCTGGAA
HKR345252 RBb63C04 pGCAP1 NM_000996.2  
ATGGATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCT
HKR360855 RBd02C07 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR361773 RBd04H05 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR363325 RBd08F05 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR364006 RBd10A06 pGCAP10 NM_000996.2  
GGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCT
HKR364032 RBd10B08 pGCAP10 NM_000996.2  
GCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
HKR364928 RBd12F08 pGCAP10 NM_000996.2  
GACCGCCATCTTGGCTCCTGTGGAGGCATGCTGGNNTNGNACTTCTACCCCNNACTATGT
HKR366029 RBd15B05 pGCAP10 NM_000996.2  
TGGCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR366833 RBd17B09 pGCAP10 NM_000996.2  
GCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
HKR366948 RBd17G04 pGCAP10 NM_000996.2  
GCTTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAG
HKR370028 RBd25B04 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR371626 RBd29B02 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR372555 RBd31G11 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR373230 RBd33B06 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR375282 RBd38D10 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR378011 RBd45A11 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR379684 RBd49D12 pGCAP10 NM_000996.2  
CGGCCGGCCGATGTCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGA
HKR381369 RBd53H01 pGCAP10 NM_000996.2  
GAATTGCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAA
HKR385603 RBd64A03 pGCAP10 NM_000996.2  
TGACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTAT
HKR386410 RBd66A10 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTNGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAACGAN
HKR392125 RBd80F05 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR393649 RBd84C01 pGCAP10 NM_000996.2  
GACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATG
HKR396928 RBd92F08 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR398404 RBd96A04 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR405550 RBdS013O14 pGCAP10 NM_000996.2  
TGCTCTTACCGCCATCTTGGCTCCTGTGGAGGTGAGTGAAGGGTCTGCTGCTGAAATTTG
HKR405910 RBdS014M22 pGCAP10 NM_000996.2  
GGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCT
HKR428171 RBdS070H03 pGCAP10 NM_000996.2  
GACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATG
HKR430087 RBdS075D15 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR432641 RBdS081K01 pGCAP10 NM_000996.2  
GATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATGTCTGGA
HKR433320 RBdS083E24 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR453061 RBdS132K21 pGCAP10 NM_000996.2  
GCTCTTACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAA
HKR461831 RBdS154J15 pGCAP10 NM_000996.2  
GACCGCCATCTTGGCTCCTGTGGAGGCCTGCTGGGAACGGGACTTCTAAAAGGAACTATG
HKR471168 RBdS177P08 pGCAP10 NM_000996.2  
GGAGTGAAGGGTCTGCTGCTGAAATTTGGGGGCAAATAACCGGAGTAGGTTTGTTCCTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl