Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00393

HP ID(1) HP00393
Gene ID(2) 6137
Gene Symbol finder RPL13
Protein Name ribosomal protein L13
RefSeq NM_033251.1
Length of RefSeq (bp) 942
Chromosome 16q24.3
Reference DDBJ accession
UniGene Hs.410817

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01G04 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARe08F01 pKA1U5 GCTTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCG
ARe16E07 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGNAGGGCCGTAGGCAGCCATGGCGCC
ARe23G06 pKA1U5 GCCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCG
ARe29A06 pKA1U5 ATGCTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGC
ARe30E07 pKA1U5 GCCTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCG
ARe32E07 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARe41B07 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARe42D08 pKA1U5 CTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCC
ARe42E08 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARe42F08 pKA1U5 GGATNNCGNTCCACNGTTNTCCTGCGANGGAGCCGCATGAGNCGTAGGCAGCCATGGNGC
ARe43A02 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARe43E10 pKA1U5 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGANCCNTAAGGCCGTAGGCAGCCATGGCGC
ARe43F10 pKA1U5 NNNNNNNTTTTNNNTTTNNGGNTTTCTCCAGGACCGCAGGGCCGTAGGCAGCCATGGCGC
ARe47D06 pKA1U5 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
ARe49G02 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGCTAGGCAGCCATGGCGC
ARe54H01 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARe60C12 pKA1U5 GATCCAGCGCCATCGGCCTGGCGCTTCAGCCAACGCGGGAGTGGATGGGCCCCTTCTTCT
ARe70E12 pKA1U5 TGCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCNTAGGGCCGTAGGCAGCCATGGCGC
ARe71H06 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGTAGGGCCGTAGGCAGCCATGGCGCC
ARe72B11 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARe72C08 pKA1U5 CTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCC
ARe73F09 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCNNTTGGCCGTAGGCAGCCATGGCGCC
ARe89D03 pKA1U5 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
ARe94F10 pKA1U5 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
ARe98A02 pKA1U5 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
ARe98F12 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARf03F10 pKA1U5 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
ARf07F10 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARi03F01 pGCAP10 GCTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
ARi04B07 pGCAP10 GGTTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCCAGCCGGAATGGC
ARi07F08 pGCAP10 GCTTTTTTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCAT
ARi11D07 pGCAP10 TCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARi14E12 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARi15F11 pGCAP10 GCTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
ARi17C12 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARi17E01 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARi18B10 pGCAP10 ATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTA
ARi20H09 pGCAP10 TGCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
ARi21G01 pGCAP10 TGCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
ARi22D11 pGCAP10 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
ARi25G11 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARi27C08 pGCAP10 GGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCCAGCCGGAATG
ARi34A08 pGCAP10 CGGCCGGCCGATGAGAGTGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGC
ARi37E12 pGCAP10 GGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCCAGCCGGAAT
ARi43A03 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARi45E11 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARi51A05 pGCAP10 GGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCCAGCCGGAAT
ARi52D01 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARi54D02 pGCAP10 TGCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
ARi56D01 pGCAP10 GGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCC
ARi57C05 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARi64C10 pGCAP10
ARi64H06 pGCAP10
ARiS008H16 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARiS013K20 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARiS020N14 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARiS045I15 pGCAP10 GGTGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGG
ARiS055P11 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARiS085C04 pGCAP10 GCTTTCCGCTCGGCNGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARiS085P21 pGCAP10 GGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCC
ARiS087A08 pGCAP10 GGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATG
ARiS088B16 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARiS088I11 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARiS096L22 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARiS109K15 pGCAP10 GCTTTCCNCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARiS118I18 pGCAP10 CTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCC
ARiS118K12 pGCAP10 GCTTTCCNCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARiS118O16 pGCAP10 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
ARiS191E10 pGCAP10 TGGGGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGG
ARiS191N09 pGCAP10 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
ARiS194F03 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
ARiS198K09 pGCAP10 GCTTTCCGCTCGGCNGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBb06D10 pKA1U5 GAGAGTGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCA
RBb06H06 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBb07A08 pKA1U5 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBb10D02 pKA1U5 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBb51F11 pGCAP1 TTTTGCTTTCCGCTCGGCTGTTTTCCTGCGCAGGGAGCCGCCNGTTNCNTTAGGCAGCCA
RBb54B05 pGCAP1 TTTGCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGC
RBb72A08 pGCAP1 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBb72C11 pGCAP1 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBd02A01 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBd10H07 pGCAP10 GCTTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATG
RBd16F06 pGCAP10 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBd19E05 pGCAP10 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBd31A09 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBd32F06 pGCAP10 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBd36F08 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBd41D06 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBd41F03 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBd44D04 pGCAP10 GCTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBd45B03 pGCAP10 GCTTTTCCCTCGGCTGTTTTCCTGCGCAAGAGCCGTGTGGCCGTAGGCAGCCATGGCGCC
RBd51B08 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBd53C02 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBd56H05 pGCAP10 TGGCGCAGGAGGTGAGGGAGACTGGGTCCTGGCCTTTGGGCNTNANNCAGCGCCATCGGC
RBd57C01 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBd63E01 pGCAP10 TGTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBd75E08 pGCAP10 GCCTTTCCGCTCGGATGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBd75H03 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBd80H12 pGCAP10 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBd84H09 pGCAP10 GGTGAGGGAGACTGGGTCCTGGCCTTTGGGCATCATCCAGCGCCATCGGCCTGGCGCTTC
RBd90D08 pGCAP10 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBd91H11 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBd92D03 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBd94E05 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBd99F01 pGCAP10 GGCGAGCCCAACGGCCGAGGCGCGCGCCGGTGGTTGGGGGAGGCGCGGGGGAGGGGCCGG
RBd99G02 pGCAP10 GAGAGTGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCA
RBdS007K12 pGCAP10 GCCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATG
RBdS007O07 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBdS014A09 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBdS015E11 pGCAP10 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBdS040B13 pGCAP10 GNTTTTTNCCNNTCNCNNGTTTNCNTGNGCAGGAGCNNCNNGGTCGNNNGGCCCNATGNN
RBdS051J02 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBdS051J23 pGCAP10 GATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGT
RBdS051K15 pGCAP10 TGGGCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGC
RBdS051L02 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCANGANCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBdS070P02 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBdS081I11 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBdS083C10 pGCAP10 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBdS104N13 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBdS132D08 pGCAP10 GGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCCAGCCGGAAT
RBdS154P16 pGCAP10 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBdS156E22 pGCAP10 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
RBdS156L10 pGCAP10 TGCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCG
RBdS156M16 pGCAP10 GCTTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCG
RBdS177B20 pGCAP10 GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
RBdS177C21 pGCAP10 GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl