Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - ARe47D06

Clone ID ARe47D06
HP ID HP00393
Gene ID 6137
Gene Symbol RPL13
Protein Name ribosomal protein L13
Vector pKA1U5
Accession No. in DDBJ
RefSeq NM_033251.1
Length of RefSeq (bp) 942
Chromosome 16q24.3
Reference DDBJ accession
UniGene Hs.410817
5'-terminal sequence GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
2011.08.28