Prev. |  KEGG KO K02873 > 

RIKEN DNA Bank Human Resource - RPL13

Gene ID NCBI Gene 6137 |  KEGG hsa:6137
Gene Symbol RPL13
Protein Name ribosomal protein L13
Synonyms BBC1|D16S444E|D16S44E|L13
Ortholog resources KEGG ortholog (KEGG orthology K02873) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007973 IRAK019P13 pCMV-SPORT6 BC013078 NM_033251 Full
HGX020948 IRAK052G04 pCMV-SPORT6 BC027463 NM_033251 Full
HGY067347 IRAK168G03 pBluescriptR BC066320 NM_033251 Full/var
HGY085538 IRAL013O02 pOTB7 BC004954 NM_033251 Full
HGY087565 IRAL018P05 pOTB7 BC006179 NM_033251 Partial/var
HGY088245 IRAL020K05 pOTB7 BC007805 NM_033251 Full
HGY088876 IRAL022D04 pOTB7 BC007563 NM_033251 Full
HGY089620 IRAL024A20 pOTB7 BC007345 NM_033251 Full
HGY090003 IRAL025A03 pOTB7 BC010994 NM_033251 Full
HGY092162 IRAL030G18 pOTB7 BC014167 NM_033251 Full
HGY094237 IRAL035J21 pDNR-LIB BC020804 NM_033251 Full
HGY100021 IRAL050A21 pOTB7 BC063378 NM_033251 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040548 ARe01G04 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR043321 ARe08F01 pKA1U5 NM_033251.1  
GCTTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCG
HKR046503 ARe16E07 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGNAGGGCCGTAGGCAGCCATGGCGCC
HKR049350 ARe23G06 pKA1U5 NM_033251.1  
GCCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCG
HKR051606 ARe29A06 pKA1U5 NM_033251.1  
ATGCTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGC
HKR052103 ARe30E07 pKA1U5 NM_033251.1  
GCCTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCG
HKR052903 ARe32E07 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR056431 ARe41B07 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR056880 ARe42D08 pKA1U5 NM_033251.1  
CTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCC
HKR056904 ARe42E08 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR056928 ARe42F08 pKA1U5 NM_033251.1  
GGATNNCGNTCCACNGTTNTCCTGCGANGGAGCCGCATGAGNCGTAGGCAGCCATGGNGC
HKR057202 ARe43A02 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR057306 ARe43E10 pKA1U5 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGANCCNTAAGGCCGTAGGCAGCCATGGCGC
HKR057330 ARe43F10 pKA1U5 NM_033251.1  
NNNNNNNTTTTNNNTTTNNGGNTTTCTCCAGGACCGCAGGGCCGTAGGCAGCCATGGCGC
HKR058878 ARe47D06 pKA1U5 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR059746 ARe49G02 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGCTAGGCAGCCATGGCGC
HKR061769 ARe54H01 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR064060 ARe60C12 pKA1U5 NM_033251.1  
GATCCAGCGCCATCGGCCTGGCGCTTCAGCCAACGCGGGAGTGGATGGGCCCCTTCTTCT
HKR068108 ARe70E12 pKA1U5 NM_033251.1  
TGCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCNTAGGGCCGTAGGCAGCCATGGCGC
HKR068574 ARe71H06 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGTAGGGCCGTAGGCAGCCATGGCGCC
HKR068835 ARe72B11 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR068856 ARe72C08 pKA1U5 NM_033251.1  
CTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCC
HKR069329 ARe73F09 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCNNTTGGCCGTAGGCAGCCATGGCGCC
HKR075675 ARe89D03 pKA1U5 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR077730 ARe94F10 pKA1U5 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR079202 ARe98A02 pKA1U5 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR079332 ARe98F12 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR081330 ARf03F10 pKA1U5 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR082930 ARf07F10 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR161321 ARi03F01 pGCAP10 NM_033251.1  
GCTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR161631 ARi04B07 pGCAP10 NM_033251.1  
GGTTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCCAGCCGGAATGGC
HKR162928 ARi07F08 pGCAP10 NM_033251.1  
GCTTTTTTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCAT
HKR164479 ARi11D07 pGCAP10 NM_033251.1  
TCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR165708 ARi14E12 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR166131 ARi15F11 pGCAP10 NM_033251.1  
GCTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR166860 ARi17C12 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR166897 ARi17E01 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR167234 ARi18B10 pGCAP10 NM_033251.1  
ATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTA
HKR168177 ARi20H09 pGCAP10 NM_033251.1  
TGCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR168545 ARi21G01 pGCAP10 NM_033251.1  
TGCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR168883 ARi22D11 pGCAP10 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR170155 ARi25G11 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR170856 ARi27C08 pGCAP10 NM_033251.1  
GGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCCAGCCGGAATG
HKR173608 ARi34A08 pGCAP10 NM_033251.1  
CGGCCGGCCGATGAGAGTGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGC
HKR174908 ARi37E12 pGCAP10 NM_033251.1  
GGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCCAGCCGGAAT
HKR177203 ARi43A03 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR178107 ARi45E11 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR180405 ARi51A05 pGCAP10 NM_033251.1  
GGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCCAGCCGGAAT
HKR180873 ARi52D01 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR181674 ARi54D02 pGCAP10 NM_033251.1  
TGCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR182473 ARi56D01 pGCAP10 NM_033251.1  
GGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCC
HKR182853 ARi57C05 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR185658 ARi64C10 pGCAP10 NM_033251.1  
HKR185774 ARi64H06 pGCAP10 NM_033251.1  
HKR203384 ARiS008H16 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR205460 ARiS013K20 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR208326 ARiS020N14 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR218207 ARiS045I15 pGCAP10 NM_033251.1  
GGTGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGG
HKR222371 ARiS055P11 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR234052 ARiS085C04 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCNGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR234381 ARiS085P21 pGCAP10 NM_033251.1  
GGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCC
HKR234808 ARiS087A08 pGCAP10 NM_033251.1  
GGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATG
HKR235240 ARiS088B16 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR235403 ARiS088I11 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR238686 ARiS096L22 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR243855 ARiS109K15 pGCAP10 NM_033251.1  
GCTTTCCNCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR247410 ARiS118I18 pGCAP10 NM_033251.1  
CTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCC
HKR247452 ARiS118K12 pGCAP10 NM_033251.1  
GCTTTCCNCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR247552 ARiS118O16 pGCAP10 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR276506 ARiS191E10 pGCAP10 NM_033251.1  
TGGGGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGG
HKR276721 ARiS191N09 pGCAP10 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR277723 ARiS194F03 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR279449 ARiS198K09 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCNGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR322482 RBb06D10 pKA1U5 NM_033251.1  
GAGAGTGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCA
HKR322574 RBb06H06 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR322808 RBb07A08 pKA1U5 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR324074 RBb10D02 pKA1U5 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR340531 RBb51F11 pGCAP1 NM_033251.1  
TTTTGCTTTCCGCTCGGCTGTTTTCCTGCGCAGGGAGCCGCCNGTTNCNTTAGGCAGCCA
HKR341629 RBb54B05 pGCAP1 NM_033251.1  
TTTGCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGC
HKR348808 RBb72A08 pGCAP1 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR348859 RBb72C11 pGCAP1 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR360801 RBd02A01 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR364175 RBd10H07 pGCAP10 NM_033251.1  
GCTTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATG
HKR366526 RBd16F06 pGCAP10 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR367701 RBd19E05 pGCAP10 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR372409 RBd31A09 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR372926 RBd32F06 pGCAP10 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR374528 RBd36F08 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR376478 RBd41D06 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR376523 RBd41F03 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR377676 RBd44D04 pGCAP10 NM_033251.1  
GCTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR378027 RBd45B03 pGCAP10 NM_033251.1  
GCTTTTCCCTCGGCTGTTTTCCTGCGCAAGAGCCGTGTGGCCGTAGGCAGCCATGGCGCC
HKR380432 RBd51B08 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR381250 RBd53C02 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR382573 RBd56H05 pGCAP10 NM_033251.1  
TGGCGCAGGAGGTGAGGGAGACTGGGTCCTGGCCTTTGGGCNTNANNCAGCGCCATCGGC
HKR382849 RBd57C01 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR385297 RBd63E01 pGCAP10 NM_033251.1  
TGTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR390104 RBd75E08 pGCAP10 NM_033251.1  
GCCTTTCCGCTCGGATGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR390171 RBd75H03 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR392180 RBd80H12 pGCAP10 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR393777 RBd84H09 pGCAP10 NM_033251.1  
GGTGAGGGAGACTGGGTCCTGGCCTTTGGGCATCATCCAGCGCCATCGGCCTGGCGCTTC
HKR396080 RBd90D08 pGCAP10 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR396579 RBd91H11 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR396875 RBd92D03 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR397701 RBd94E05 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR399721 RBd99F01 pGCAP10 NM_033251.1  
GGCGAGCCCAACGGCCGAGGCGCGCGCCGGTGGTTGGGGGAGGCGCGGGGGAGGGGCCGG
HKR399746 RBd99G02 pGCAP10 NM_033251.1  
GAGAGTGCATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCA
HKR403052 RBdS007K12 pGCAP10 NM_033251.1  
GCCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATG
HKR403143 RBdS007O07 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR405609 RBdS014A09 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR406107 RBdS015E11 pGCAP10 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR416037 RBdS040B13 pGCAP10 NM_033251.1  
GNTTTTTNCCNNTCNCNNGTTTNCNTGNGCAGGAGCNNCNNGGTCGNNNGGCCCNATGNN
HKR420618 RBdS051J02 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR420639 RBdS051J23 pGCAP10 NM_033251.1  
GATTGCGGGGCCGCTTCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGT
HKR420655 RBdS051K15 pGCAP10 NM_033251.1  
TGGGCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGC
HKR420666 RBdS051L02 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCANGANCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR428362 RBdS070P02 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR432603 RBdS081I11 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR433258 RBdS083C10 pGCAP10 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR441925 RBdS104N13 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR452880 RBdS132D08 pGCAP10 NM_033251.1  
GGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCCCAGCCGGAAT
HKR461976 RBdS154P16 pGCAP10 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR462518 RBdS156E22 pGCAP10 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC
HKR462674 RBdS156L10 pGCAP10 NM_033251.1  
TGCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCG
HKR462704 RBdS156M16 pGCAP10 NM_033251.1  
GCTTTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCG
HKR470844 RBdS177B20 pGCAP10 NM_033251.1  
GCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGCC
HKR470869 RBdS177C21 pGCAP10 NM_033251.1  
GCCTTTCCGCTCGGCTGTTTTCCTGCGCAGGAGCCGCAGGGCCGTAGGCAGCCATGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl