Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00379

HP ID(1) HP00379
Gene ID(2) 6169
Gene Symbol finder RPL38
Protein Name ribosomal protein L38
RefSeq NM_000999.3
Length of RefSeq (bp) 411
Chromosome 17q23-q25
Reference DDBJ accession
UniGene Hs.380953

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01H07 pKA1U5 GCTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGTTGNGAGTGTCTCTAGGGTGATACG
ARe30H04 pKA1U5 TGCTTTTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGA
ARe55G10 pKA1U5 TGCTTTTTCGTCCTTTTCCCCGGATTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGT
ARe79F03 pKA1U5 GCTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCA
ARe92D12 pKA1U5 GGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAG
ARi12H05 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
ARi22A06 pGCAP10 CTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGG
ARi32H09 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
ARi35G08 pGCAP10 CTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGG
ARi38D06 pGCAP10 GCTTTTTCGNNCTTTCCCGGTGCTGCTTGCTGTCCTGGTCCGCGCAGANCCCAGCGCGCC
ARi52E07 pGCAP10 TTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTC
ARiS020K09 pGCAP10 GGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
ARiS020O09 pGCAP10 TGGGTGTCTCTAGGGNGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAGCG
ARiS045F04 pGCAP10 GCTTTTTTCNTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTG
ARiS055L02 pGCAP10 GCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTC
ARiS096G14 pGCAP10 GGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCA
ARiS161M13 pGCAP10 GCTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
RBb04E11 pKA1U5 GGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAGCGCGCC
RBb26A02 pGCAP1 GGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCG
RBb34A10 pGCAP1 TGGAGGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAG
RBb39B05 pGCAP1 GTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAG
RBb47A02 pGCAP1 NAGTGCCCCCGGNTTGCTGCTTGCTGNTGAAGTGTCTCTAGGGNTGATACGNTGGGTGAG
RBb53C05 pGCAP1 GTGGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGANAAAGGTCCTGGTCCGC
RBb62H01 pGCAP1 TGAACGGAGTCTCGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTC
RBd02E08 pGCAP10 GCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGG
RBd03B12 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
RBd06D02 pGCAP10 TTTTTTTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATAC
RBd06G10 pGCAP10 GGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAG
RBd09F04 pGCAP10 GGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
RBd15F04 pGCAP10 GGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAG
RBd18B04 pGCAP10 GCTTTTTTCCTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTG
RBd18F11 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
RBd20D07 pGCAP10 GCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCGCGCCTCGTCG
RBd20E04 pGCAP10 GGTCTCGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTG
RBd26C07 pGCAP10 GGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
RBd29G04 pGCAP10 GGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAG
RBd29G08 pGCAP10 GTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTG
RBd31E07 pGCAP10 TTTTGGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAGCG
RBd31H01 pGCAP10 CTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCGC
RBd35A04 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
RBd35H11 pGCAP10 GGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAG
RBd38D04 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
RBd40E05 pGCAP10 GCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGG
RBd40G03 pGCAP10 GCTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
RBd46E04 pGCAP10 GCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCGCGCCTCGTCG
RBd49A05 pGCAP10 GCTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
RBd74E05 pGCAP10 GGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCC
RBd76F07 pGCAP10 GGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
RBd78E09 pGCAP10 GGTTNTTTTNCGCCCTTTTCCCCGGTTGGTGCTTGCTGNGAGTGTCTCTAGGGTGANANN
RBd82A04 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
RBd86G04 pGCAP10 GCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGG
RBd87H10 pGCAP10 GCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAGCGCGCCTC
RBd89B01 pGCAP10 GGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAG
RBd91A12 pGCAP10 GGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCA
RBd97D12 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
RBd99F07 pGCAP10 GGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAG
RBdS013J22 pGCAP10 GCTTTTTTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATA
RBdS013L22 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
RBdS015F02 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
RBdS015M06 pGCAP10 GGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
RBdS051F15 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
RBdS051M19 pGCAP10 GCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGG
RBdS051N05 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
RBdS051O02 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
RBdS070I18 pGCAP10 GGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAGCGCG
RBdS070I23 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
RBdS075N22 pGCAP10 GGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAA
RBdS104D24 pGCAP10 GCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGG
RBdS105A21 pGCAP10 GGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGC
RBdS105B16 pGCAP10 GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
RBdS105N08 pGCAP10 GGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAGCGCGCC
RBdS110C19 pGCAP10 GGTCTCTAGGGTGATNCGTGGGTGAGAAAGGTAATCTGGGGCAATCCACTGCCAGGTGAA
RBdS110L22 pGCAP10 CGGCCGGCCGATGCTTTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCT
RBdS156O14 pGCAP10 GCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGG
RBdS177N13 pGCAP10 TGCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGC
RBdS187I13 pGCAP10 TGGCCTCAGGGAAGCGAGCCCGGGCGCCGGCGGGCGGCCGTCGCGTCTGACAGACCACTG
RBdS187I11 pGCAP10 GCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl