Prev. |  KEGG KO K02923 > 

RIKEN DNA Bank Human Resource - RPL38

Gene ID NCBI Gene 6169 |  KEGG hsa:6169
Gene Symbol RPL38
Protein Name ribosomal protein L38
Synonyms L38
Ortholog resources KEGG ortholog (KEGG orthology K02923) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082112 IRAL005E16 pOTB7 BC000603 NM_001035258 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040575 ARe01H07 pKA1U5 NM_000999.3  
GCTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGTTGNGAGTGTCTCTAGGGTGATACG
HKR052172 ARe30H04 pKA1U5 NM_000999.3  
TGCTTTTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGA
HKR062154 ARe55G10 pKA1U5 NM_000999.3  
TGCTTTTTCGTCCTTTTCCCCGGATTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGT
HKR071723 ARe79F03 pKA1U5 NM_000999.3  
GCTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCA
HKR076884 ARe92D12 pKA1U5 NM_000999.3  
GGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAG
HKR164973 ARi12H05 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
HKR168806 ARi22A06 pGCAP10 NM_000999.3  
CTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGG
HKR172977 ARi32H09 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
HKR174152 ARi35G08 pGCAP10 NM_000999.3  
CTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGG
HKR175278 ARi38D06 pGCAP10 NM_000999.3  
GCTTTTTCGNNCTTTCCCGGTGCTGCTTGCTGTCCTGGTCCGCGCAGANCCCAGCGCGCC
HKR180903 ARi52E07 pGCAP10 NM_000999.3  
TTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTC
HKR208249 ARiS020K09 pGCAP10 NM_000999.3  
GGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
HKR208345 ARiS020O09 pGCAP10 NM_000999.3  
TGGGTGTCTCTAGGGNGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAGCG
HKR218124 ARiS045F04 pGCAP10 NM_000999.3  
GCTTTTTTCNTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTG
HKR222266 ARiS055L02 pGCAP10 NM_000999.3  
GCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTC
HKR238558 ARiS096G14 pGCAP10 NM_000999.3  
GGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCA
HKR264701 ARiS161M13 pGCAP10 NM_000999.3  
GCTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
HKR321707 RBb04E11 pKA1U5 NM_000999.3  
GGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAGCGCGCC
HKR330402 RBb26A02 pGCAP1 NM_000999.3  
GGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCG
HKR333610 RBb34A10 pGCAP1 NM_000999.3  
TGGAGGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAG
HKR335629 RBb39B05 pGCAP1 NM_000999.3  
GTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAG
HKR338802 RBb47A02 pGCAP1 NM_000999.3  
NAGTGCCCCCGGNTTGCTGCTTGCTGNTGAAGTGTCTCTAGGGNTGATACGNTGGGTGAG
HKR341253 RBb53C05 pGCAP1 NM_000999.3  
GTGGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGANAAAGGTCCTGGTCCGC
HKR344969 RBb62H01 pGCAP1 NM_000999.3  
TGAACGGAGTCTCGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTC
HKR360904 RBd02E08 pGCAP10 NM_000999.3  
GCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGG
HKR361236 RBd03B12 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
HKR362474 RBd06D02 pGCAP10 NM_000999.3  
TTTTTTTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATAC
HKR362554 RBd06G10 pGCAP10 NM_000999.3  
GGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAG
HKR363724 RBd09F04 pGCAP10 NM_000999.3  
GGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
HKR366124 RBd15F04 pGCAP10 NM_000999.3  
GGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAG
HKR367228 RBd18B04 pGCAP10 NM_000999.3  
GCTTTTTTCCTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTG
HKR367331 RBd18F11 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
HKR368079 RBd20D07 pGCAP10 NM_000999.3  
GCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCGCGCCTCGTCG
HKR368100 RBd20E04 pGCAP10 NM_000999.3  
GGTCTCGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTG
HKR370455 RBd26C07 pGCAP10 NM_000999.3  
GGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
HKR371748 RBd29G04 pGCAP10 NM_000999.3  
GGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAG
HKR371752 RBd29G08 pGCAP10 NM_000999.3  
GTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTG
HKR372503 RBd31E07 pGCAP10 NM_000999.3  
TTTTGGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAGCG
HKR372569 RBd31H01 pGCAP10 NM_000999.3  
CTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCGC
HKR374004 RBd35A04 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
HKR374179 RBd35H11 pGCAP10 NM_000999.3  
GGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAG
HKR375276 RBd38D04 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
HKR376101 RBd40E05 pGCAP10 NM_000999.3  
GCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGG
HKR376147 RBd40G03 pGCAP10 NM_000999.3  
GCTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
HKR378500 RBd46E04 pGCAP10 NM_000999.3  
GCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCGCGCCTCGTCG
HKR379605 RBd49A05 pGCAP10 NM_000999.3  
GCTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
HKR389701 RBd74E05 pGCAP10 NM_000999.3  
GGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCC
HKR390527 RBd76F07 pGCAP10 NM_000999.3  
GGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
HKR391305 RBd78E09 pGCAP10 NM_000999.3  
GGTTNTTTTNCGCCCTTTTCCCCGGTTGGTGCTTGCTGNGAGTGTCTCTAGGGTGANANN
HKR392804 RBd82A04 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
HKR394548 RBd86G04 pGCAP10 NM_000999.3  
GCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGG
HKR394978 RBd87H10 pGCAP10 NM_000999.3  
GCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAGCGCGCCTC
HKR395625 RBd89B01 pGCAP10 NM_000999.3  
GGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAG
HKR396412 RBd91A12 pGCAP10 NM_000999.3  
GGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCA
HKR398884 RBd97D12 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
HKR399727 RBd99F07 pGCAP10 NM_000999.3  
GGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAG
HKR405438 RBdS013J22 pGCAP10 NM_000999.3  
GCTTTTTTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATA
HKR405486 RBdS013L22 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
HKR406122 RBdS015F02 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
HKR406294 RBdS015M06 pGCAP10 NM_000999.3  
GGTTCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACG
HKR420535 RBdS051F15 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
HKR420707 RBdS051M19 pGCAP10 NM_000999.3  
GCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGG
HKR420717 RBdS051N05 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGG
HKR420738 RBdS051O02 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
HKR428210 RBdS070I18 pGCAP10 NM_000999.3  
GGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAGCGCG
HKR428215 RBdS070I23 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
HKR430334 RBdS075N22 pGCAP10 NM_000999.3  
GGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAA
HKR441696 RBdS104D24 pGCAP10 NM_000999.3  
GCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGG
HKR442021 RBdS105A21 pGCAP10 NM_000999.3  
GGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGC
HKR442040 RBdS105B16 pGCAP10 NM_000999.3  
GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
HKR442320 RBdS105N08 pGCAP10 NM_000999.3  
GGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGTCCGCGCCAGAGCCCAGCGCGCC
HKR444067 RBdS110C19 pGCAP10 NM_000999.3  
GGTCTCTAGGGTGATNCGTGGGTGAGAAAGGTAATCTGGGGCAATCCACTGCCAGGTGAA
HKR444286 RBdS110L22 pGCAP10 NM_000999.3  
CGGCCGGCCGATGCTTTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCT
HKR462750 RBdS156O14 pGCAP10 NM_000999.3  
GCTTTTCCCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGG
HKR471125 RBdS177N13 pGCAP10 NM_000999.3  
TGCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGC
HKR475003 RBdS187I11 pGCAP10 NM_000999.3  
GCCGGTTGCTGCTTGCTGTGAGTGTCTCTAGGGTGATACGTGGGTGAGAAAGGTCCTGGT
HKR475005 RBdS187I13 pGCAP10 NM_000999.3  
TGGCCTCAGGGAAGCGAGCCCGGGCGCCGGCGGGCGGCCGTCGCGTCTGACAGACCACTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl