Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015F02

Clone ID RBdS015F02
HP ID HP00379
Gene ID 6169
Gene Symbol RPL38
Protein Name ribosomal protein L38
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000999.3
Length of RefSeq (bp) 411
Chromosome 17q23-q25
Reference DDBJ accession
UniGene Hs.380953
5'-terminal sequence GCTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCG
2011.08.28