Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00373

HP ID(1) HP00373
Gene ID(2) 6207
Gene Symbol finder RPS13
Protein Name ribosomal protein S13
RefSeq NM_001017.2
Length of RefSeq (bp) 529
Chromosome 11p15
Reference DDBJ accession
UniGene Hs.446588

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01A01 pKA1U5 GCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
ARe03B12 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARe04A06 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARe08G11 pKA1U5 ATCCTGGCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAG
ARe19G08 pKA1U5 GCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTTNGCATGCATGCTCCCGGGAAGGGC
ARe25F07 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARe26C07 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARe34H07 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGCTCGCATGCATGCTCCCGGGAAGGGCCT
ARe35D05 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGNCGCNTGCATGCTCCCGGGAAGGGCCTG
ARe35E06 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGCTCGCATGCATGCTCCCGGGAAGGGCCT
ARe37A10 pKA1U5 GCCTTTCGCTTGCCTGATCNCCGCCNTCANGGNATCNCNTGCNTGCTCCCGGGCAAGGGC
ARe38H03 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARe40E01 pKA1U5 CCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
ARe40H12 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARe42A05 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARe46C08 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARe52E10 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGNCCNTTGCNTGCTCCCGGGAAGGGCCTG
ARe56G12 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGCCNTTNGCATGCTCCCGGGAAGGGCCTG
ARe67G05 pKA1U5 ATCCTGTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAG
ARe68E09 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARe69B01 pKA1U5 TGGAGCCTTTTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGG
ARe74E01 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARe75D11 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGCCGNTTGCATGCTCCCGGGAAGGGCCTG
ARe75G05 pKA1U5 GCTTTTCGTTGCCTGATCGCCGCCATCATGGGNCGNNTGCATGCTCCCGGGAAGGGCCTG
ARe81A05 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARe91A10 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGCTCGCATGCATGCTCCCGGGAAGGGCCT
ARe92C12 pKA1U5 GCCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
ARe93F10 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARe94C04 pKA1U5 GCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
ARe94C11 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARe96F10 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARf02D06 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARf03A03 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARf05B06 pKA1U5 GCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCC
ARf07D01 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARi04E07 pGCAP10 GCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
ARi08F03 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARi11F09 pGCAP10 CCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
ARi14C03 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARi18B05 pGCAP10 GCTTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
ARi18H02 pGCAP10 CCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
ARi19A12 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARi23C09 pGCAP10 GCCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGGCCTGTCC
ARi29A08 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARi31C07 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARi33C11 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARi34G05 pGCAP10 GCTGTCCGCGGGGAGGCTTCTTGCGGCGTTTGGCTCTCGCTCTCCTTTCCGCCGGANTTT
ARi35C02 pGCAP10 GCCTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
ARi42D06 pGCAP10 GCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCC
ARi43B07 pGCAP10 TCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARi44D06 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARi45H11 pGCAP10 GGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGTCCCAGTCG
ARi46B06 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARi48C03 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARi48D04 pGCAP10 GCCTTTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGC
ARi48E12 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARi54H06 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARi59E05 pGCAP10 TGCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCCTGCTCCCGGGAAGGGCCT
ARiS013D21 pGCAP10 GGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGTCCCAGTCG
ARiS013I23 pGCAP10 GTCCTTTCGTTGCCTNNTCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
ARiS020B11 pGCAP10 GCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCC
ARiS020J22 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARiS049L03 pGCAP10 GCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
ARiS055F13 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARiS085J17 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARiS087B07 pGCAP10 TCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARiS087N21 pGCAP10
ARiS088J16 pGCAP10 GGCTCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGG
ARiS088L16 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARiS096A19 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARiS096K18 pGCAP10 GCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCC
ARiS118C02 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARiS150C14 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARiS150G02 pGCAP10 GGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGTCCCAGTCG
ARiS150N22 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARiS161D14 pGCAP10 GCTTTCGTTGCCTGATCGCCNCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
ARiS161M05 pGCAP10 CCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
ARiS191E06 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARiS191K03 pGCAP10 TTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
ARiS194H12 pGCAP10 GCCTTTCNTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARiS198D06 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
ARiS198H04 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGGCCTGTCCC
RBb01G08 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBb08B02 pKA1U5 GCCTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
RBb14G12 pKA1U5 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGCTCGCNTGCATGCTCCCGGGAAGGGCCT
RBb28D01 pGCAP1 GCCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
RBb30H01 pGCAP1 GTCTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
RBb44C01 pGCAP1 TGCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGC
RBb44D01 pGCAP1 TGCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGC
RBb51G05 pGCAP1 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBb54A05 pGCAP1 GCCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
RBb67C07 pGCAP1 TTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGTCC
RBd01C06 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBd07D12 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBd11H10 pGCAP10 GGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGTCCCAGTCGGCTT
RBd20C11 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBd24H03 pGCAP10 GTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGTC
RBd29E07 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBd30G02 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBd35E02 pGCAP10 GACTCTCGCTCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCG
RBd41E10 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBd50D03 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBd62A04 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBd62F05 pGCAP10 GGCTCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGG
RBd63E10 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBd70A05 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBd71E02 pGCAP10 TGCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
RBd75H01 pGCAP10 GTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
RBd79C01 pGCAP10 GGTTTCCACTCTCGCTCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATG
RBd87G03 pGCAP10 GCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCC
RBd91A03 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBd98H06 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBdS007N20 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBdS013P05 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBdS014H23 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBdS014K14 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBdS014O10 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBdS051I08 pGCAP10 TCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBdS075E21 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBdS075M05 pGCAP10 GCCTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
RBdS083C08 pGCAP10 GCCTTNCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBdS132A14 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBdS132C12 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBdS132P03 pGCAP10 TGCCTTTTTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAG
RBdS156C22 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBdS177H11 pGCAP10 GCCTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
RBdS187A21 pGCAP10 GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
RBdS187D15 pGCAP10 GTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl