Prev. |  KEGG KO K02953 > 

RIKEN DNA Bank Human Resource - RPS13

Gene ID NCBI Gene 6207 |  KEGG hsa:6207
Gene Symbol RPS13
Protein Name ribosomal protein S13
Synonyms S13
Ortholog resources KEGG ortholog (KEGG orthology K02953) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001351 IRAK003G07 pCMV-SPORT6 BC006772 NM_001017 Full
HGX010774 IRAK026P14 pCMV-SPORT6 BC029732 NM_001017 Full
HGY066883 IRAK167D11 pBluescriptR BC066322 NM_001017 Full
HGY080727 IRAL001N15 pOTB7 BC000475 NM_001017 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040401 ARe01A01 pKA1U5 NM_001017.2  
GCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
HKR041236 ARe03B12 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR041606 ARe04A06 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR043355 ARe08G11 pKA1U5 NM_001017.2  
ATCCTGGCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAG
HKR047752 ARe19G08 pKA1U5 NM_001017.2  
GCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTTNGCATGCATGCTCCCGGGAAGGGC
HKR050127 ARe25F07 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR050455 ARe26C07 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR053775 ARe34H07 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGCTCGCATGCATGCTCCCGGGAAGGGCCT
HKR054077 ARe35D05 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGNCGCNTGCATGCTCCCGGGAAGGGCCTG
HKR054102 ARe35E06 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGCTCGCATGCATGCTCCCGGGAAGGGCCT
HKR054810 ARe37A10 pKA1U5 NM_001017.2  
GCCTTTCGCTTGCCTGATCNCCGCCNTCANGGNATCNCNTGCNTGCTCCCGGGCAAGGGC
HKR055371 ARe38H03 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR056097 ARe40E01 pKA1U5 NM_001017.2  
CCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
HKR056180 ARe40H12 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR056805 ARe42A05 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR058456 ARe46C08 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR060906 ARe52E10 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGNCCNTTGCNTGCTCCCGGGAAGGGCCTG
HKR062556 ARe56G12 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGCCNTTNGCATGCTCCCGGGAAGGGCCTG
HKR066949 ARe67G05 pKA1U5 NM_001017.2  
ATCCTGTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAG
HKR067305 ARe68E09 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR067625 ARe69B01 pKA1U5 NM_001017.2  
TGGAGCCTTTTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGG
HKR069697 ARe74E01 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR070083 ARe75D11 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGCCGNTTGCATGCTCCCGGGAAGGGCCTG
HKR070149 ARe75G05 pKA1U5 NM_001017.2  
GCTTTTCGTTGCCTGATCGCCGCCATCATGGGNCGNNTGCATGCTCCCGGGAAGGGCCTG
HKR072405 ARe81A05 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR076410 ARe91A10 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGCTCGCATGCATGCTCCCGGGAAGGGCCT
HKR076860 ARe92C12 pKA1U5 NM_001017.2  
GCCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
HKR077330 ARe93F10 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR077652 ARe94C04 pKA1U5 NM_001017.2  
GCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
HKR077659 ARe94C11 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR078530 ARe96F10 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR080878 ARf02D06 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR081203 ARf03A03 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR082030 ARf05B06 pKA1U5 NM_001017.2  
GCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCC
HKR082873 ARf07D01 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR161703 ARi04E07 pGCAP10 NM_001017.2  
GCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
HKR163323 ARi08F03 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR164529 ARi11F09 pGCAP10 NM_001017.2  
CCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
HKR165651 ARi14C03 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR167229 ARi18B05 pGCAP10 NM_001017.2  
GCTTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
HKR167370 ARi18H02 pGCAP10 NM_001017.2  
CCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
HKR167612 ARi19A12 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR169257 ARi23C09 pGCAP10 NM_001017.2  
GCCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGGCCTGTCC
HKR171608 ARi29A08 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR172455 ARi31C07 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR173259 ARi33C11 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR173749 ARi34G05 pGCAP10 NM_001017.2  
GCTGTCCGCGGGGAGGCTTCTTGCGGCGTTTGGCTCTCGCTCTCCTTTCCGCCGGANTTT
HKR174050 ARi35C02 pGCAP10 NM_001017.2  
GCCTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
HKR176878 ARi42D06 pGCAP10 NM_001017.2  
GCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCC
HKR177231 ARi43B07 pGCAP10 NM_001017.2  
TCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR177678 ARi44D06 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR178179 ARi45H11 pGCAP10 NM_001017.2  
GGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGTCCCAGTCG
HKR178430 ARi46B06 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR179251 ARi48C03 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR179276 ARi48D04 pGCAP10 NM_001017.2  
GCCTTTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGC
HKR179308 ARi48E12 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR181774 ARi54H06 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR183701 ARi59E05 pGCAP10 NM_001017.2  
TGCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCCTGCTCCCGGGAAGGGCCT
HKR205293 ARiS013D21 pGCAP10 NM_001017.2  
GGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGTCCCAGTCG
HKR205415 ARiS013I23 pGCAP10 NM_001017.2  
GTCCTTTCGTTGCCTNNTCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
HKR208035 ARiS020B11 pGCAP10 NM_001017.2  
GCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCC
HKR208238 ARiS020J22 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR219867 ARiS049L03 pGCAP10 NM_001017.2  
GCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
HKR222133 ARiS055F13 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR234233 ARiS085J17 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR234831 ARiS087B07 pGCAP10 NM_001017.2  
TCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR235133 ARiS087N21 pGCAP10 NM_001017.2  
HKR235432 ARiS088J16 pGCAP10 NM_001017.2  
GGCTCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGG
HKR235480 ARiS088L16 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR238419 ARiS096A19 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR238658 ARiS096K18 pGCAP10 NM_001017.2  
GCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCC
HKR247250 ARiS118C02 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR260062 ARiS150C14 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR260146 ARiS150G02 pGCAP10 NM_001017.2  
GGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGTCCCAGTCG
HKR260334 ARiS150N22 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR264486 ARiS161D14 pGCAP10 NM_001017.2  
GCTTTCGTTGCCTGATCGCCNCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
HKR264693 ARiS161M05 pGCAP10 NM_001017.2  
CCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
HKR276502 ARiS191E06 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR276643 ARiS191K03 pGCAP10 NM_001017.2  
TTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGT
HKR277780 ARiS194H12 pGCAP10 NM_001017.2  
GCCTTTCNTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR279278 ARiS198D06 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR279372 ARiS198H04 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGGCCTGTCCC
HKR320552 RBb01G08 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR323226 RBb08B02 pKA1U5 NM_001017.2  
GCCTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
HKR325756 RBb14G12 pKA1U5 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGCTCGCNTGCATGCTCCCGGGAAGGGCCT
HKR331273 RBb28D01 pGCAP1 NM_001017.2  
GCCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
HKR332169 RBb30H01 pGCAP1 NM_001017.2  
GTCTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
HKR337649 RBb44C01 pGCAP1 NM_001017.2  
TGCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGC
HKR337673 RBb44D01 pGCAP1 NM_001017.2  
TGCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGC
HKR340549 RBb51G05 pGCAP1 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR341605 RBb54A05 pGCAP1 NM_001017.2  
GCCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
HKR346855 RBb67C07 pGCAP1 NM_001017.2  
TTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGTCC
HKR360454 RBd01C06 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR362884 RBd07D12 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR364578 RBd11H10 pGCAP10 NM_001017.2  
GGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGTCCCAGTCGGCTT
HKR368059 RBd20C11 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR369771 RBd24H03 pGCAP10 NM_001017.2  
GTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTGTC
HKR371703 RBd29E07 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR372146 RBd30G02 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR374098 RBd35E02 pGCAP10 NM_001017.2  
GACTCTCGCTCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCG
HKR376506 RBd41E10 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR380075 RBd50D03 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR384804 RBd62A04 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR384925 RBd62F05 pGCAP10 NM_001017.2  
GGCTCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGG
HKR385306 RBd63E10 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR388005 RBd70A05 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR388498 RBd71E02 pGCAP10 NM_001017.2  
TGCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
HKR390169 RBd75H01 pGCAP10 NM_001017.2  
GTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
HKR391649 RBd79C01 pGCAP10 NM_001017.2  
GGTTTCCACTCTCGCTCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATG
HKR394947 RBd87G03 pGCAP10 NM_001017.2  
GCTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCC
HKR396403 RBd91A03 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR399374 RBd98H06 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR403132 RBdS007N20 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR405565 RBdS013P05 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR405791 RBdS014H23 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR405854 RBdS014K14 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR405946 RBdS014O10 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR420600 RBdS051I08 pGCAP10 NM_001017.2  
TCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR430117 RBdS075E21 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR430293 RBdS075M05 pGCAP10 NM_001017.2  
GCCTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
HKR433256 RBdS083C08 pGCAP10 NM_001017.2  
GCCTTNCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR452814 RBdS132A14 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR452860 RBdS132C12 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR453163 RBdS132P03 pGCAP10 NM_001017.2  
TGCCTTTTTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAG
HKR462470 RBdS156C22 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR470979 RBdS177H11 pGCAP10 NM_001017.2  
GCCTTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT
HKR474821 RBdS187A21 pGCAP10 NM_001017.2  
GCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
HKR474887 RBdS187D15 pGCAP10 NM_001017.2  
GTCCTTTCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl