Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083C08

Clone ID RBdS083C08
HP ID HP00373
Gene ID 6207
Gene Symbol RPS13
Protein Name ribosomal protein S13
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001017.2
Length of RefSeq (bp) 529
Chromosome 11p15
Reference DDBJ accession
UniGene Hs.446588
5'-terminal sequence GCCTTNCGTTGCCTGATCGCCGCCATCATGGGTCGCATGCATGCTCCCGGGAAGGGCCTG
2011.08.28