Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00365

HP ID(1) HP00365
Gene ID(2) 6229
Gene Symbol finder RPS24
Protein Name ribosomal protein S24
RefSeq NM_033022.3
Length of RefSeq (bp) 671
Chromosome 10q22-q23
Reference DDBJ accession
UniGene Hs.280130

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02C07 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
ARe09C12 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
ARe13D10 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARe22E11 pKA1U5 GTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTAT
ARe23B01 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARe25C04 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
ARe35F03 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARe36C01 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARe39H12 pKA1U5 GCTCTTTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACT
ARe44F08 pKA1U5 TTGGCGTGCGCGTTTGATATGATTGGCCGGCGAATCGTGGTTCTCTTTTCCTCCTTGGCT
ARe47C12 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
ARe49H08 pKA1U5 GTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTAT
ARe50A07 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
ARe50C12 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
ARe51C03 pKA1U5 AGATAGATCGCCATCATGAACGACACCGNTAACTATCCGCACTAGAAAGTTCATGACCAA
ARe52G11 pKA1U5 GCTTTTCCTCCTTGGNTGTCTGAANATAGATCCCCTTTATGAACGACNCCGTTAACTATC
ARe61G07 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCNCNNTCATGAACGACACCGTAACTAT
ARe71D04 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
ARe74H05 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
ARe75E11 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCNATCATGAACGACACCGNTAACTA
ARe83E02 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARe86A06 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARe86C11 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARe96A02 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
ARe98G01 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARf03C01 pKA1U5 CCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCCCCNTCATGNAACGACACCGTAACTA
ARf03G11 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
ARi01F04 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARi09F12 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARi11B10 pGCAP10 GGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACC
ARi30G02 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARi48H07 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARi50C05 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARi62G03 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARi65A11 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARi65G12 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARi70H12 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARiS055E02 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARiS087I22 pGCAP10
ARiS088K18 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCNTCATGAACGACACCGTAACTAT
ARiS109F21 pGCAP10 GGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACC
ARiS109I10 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARiS118F21 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARiS118G01 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARiS122D01 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARiS122K13 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARiS161H17 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
ARiS198P07 pGCAP10 GCTCTNCNCCTCCNNGGCNGTCNGAANANAGATCGCCATCATGAACGACACCGTAACTAT
RBb08C09 pKA1U5 CCTAATGCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGT
RBb20D06 pKA1U5 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBb32C08 pGCAP1 TTCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACT
RBb33E08 pGCAP1 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
RBb36F11 pGCAP1 AATGTGAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACCA
RBb41D10 pGCAP1 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBb41E08 pGCAP1 TTTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
RBb48A11 pGCAP1 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
RBb48C12 pGCAP1 TGCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTA
RBb55D11 pGCAP1 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBb59D05 pGCAP1 TGGCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACT
RBb63F09 pGCAP1 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd08F08 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd10D09 pGCAP10 GTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCAC
RBd10E03 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd10E11 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd11D07 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd13F08 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd22G01 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd28D04 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd29C12 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd35F04 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd35F08 pGCAP10 TGCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTA
RBd38E10 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd48A08 pGCAP10 GCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCC
RBd48E09 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd51G04 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd52B10 pGCAP10 TCCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTA
RBd52F01 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd53A04 pGCAP10 GCTTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATC
RBd53A06 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd59E12 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd65C12 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd71G01 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd76A03 pGCAP10 GTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATC
RBd77A06 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd82C12 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd82D07 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd82E09 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd93B11 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBd94C03 pGCAP10 GGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGT
RBdS013H11 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBdS013I18 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBdS015E09 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBdS022L10 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNAACTAT
RBdS022P08 pGCAP10 GGTTCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAAC
RBdS022P15 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBdS040N01 pGCAP10 GCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCC
RBdS075D11 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBdS075K02 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBdS083C12 pGCAP10 GAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACCAA
RBdS105O11 pGCAP10 GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
RBdS156H11 pGCAP10 GGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl