Prev. |  KEGG KO K02974 > 

RIKEN DNA Bank Human Resource - RPS24

Gene ID NCBI Gene 6229 |  KEGG hsa:6229
Gene Symbol RPS24
Protein Name ribosomal protein S24
Synonyms DBA3|S24
Ortholog resources KEGG ortholog (KEGG orthology K02974) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080674 IRAL001L10 pOTB7 BC000523 NM_033022 Full
HGY083838 IRAL009J22 pOTB7 BC003149 NM_033022 Full
HGY103392 IRAL058H24 pOTB7 BC071926 NM_033022 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040855 ARe02C07 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
HKR043660 ARe09C12 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
HKR045282 ARe13D10 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR048907 ARe22E11 pKA1U5 NM_033022.3  
GTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTAT
HKR049225 ARe23B01 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR050052 ARe25C04 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
HKR054123 ARe35F03 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR054449 ARe36C01 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR055780 ARe39H12 pKA1U5 NM_033022.3  
GCTCTTTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACT
HKR057728 ARe44F08 pKA1U5 NM_033022.3  
TTGGCGTGCGCGTTTGATATGATTGGCCGGCGAATCGTGGTTCTCTTTTCCTCCTTGGCT
HKR058860 ARe47C12 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
HKR059776 ARe49H08 pKA1U5 NM_033022.3  
GTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTAT
HKR060007 ARe50A07 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
HKR060060 ARe50C12 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
HKR060451 ARe51C03 pKA1U5 NM_033022.3  
AGATAGATCGCCATCATGAACGACACCGNTAACTATCCGCACTAGAAAGTTCATGACCAA
HKR060955 ARe52G11 pKA1U5 NM_033022.3  
GCTTTTCCTCCTTGGNTGTCTGAANATAGATCCCCTTTATGAACGACNCCGTTAACTATC
HKR064551 ARe61G07 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCNCNNTCATGAACGACACCGTAACTAT
HKR068476 ARe71D04 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
HKR069773 ARe74H05 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
HKR070107 ARe75E11 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCNATCATGAACGACACCGNTAACTA
HKR073298 ARe83E02 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR074406 ARe86A06 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR074459 ARe86C11 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR078402 ARe96A02 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
HKR079345 ARe98G01 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR081249 ARf03C01 pKA1U5 NM_033022.3  
CCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCCCCNTCATGNAACGACACCGTAACTA
HKR081355 ARf03G11 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
HKR160524 ARi01F04 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR163732 ARi09F12 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR164434 ARi11B10 pGCAP10 NM_033022.3  
GGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACC
HKR172146 ARi30G02 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR179375 ARi48H07 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR180053 ARi50C05 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR184947 ARi62G03 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR186011 ARi65A11 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR186156 ARi65G12 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR188180 ARi70H12 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR222098 ARiS055E02 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR235014 ARiS087I22 pGCAP10 NM_033022.3  
HKR235458 ARiS088K18 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCNTCATGAACGACACCGTAACTAT
HKR243741 ARiS109F21 pGCAP10 NM_033022.3  
GGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACC
HKR243802 ARiS109I10 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR247341 ARiS118F21 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR247345 ARiS118G01 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR248873 ARiS122D01 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR249053 ARiS122K13 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR264585 ARiS161H17 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR279567 ARiS198P07 pGCAP10 NM_033022.3  
GCTCTNCNCCTCCNNGGCNGTCNGAANANAGATCGCCATCATGAACGACACCGTAACTAT
HKR323257 RBb08C09 pKA1U5 NM_033022.3  
CCTAATGCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGT
HKR328078 RBb20D06 pKA1U5 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR332856 RBb32C08 pGCAP1 NM_033022.3  
TTCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACT
HKR333304 RBb33E08 pGCAP1 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
HKR334531 RBb36F11 pGCAP1 NM_033022.3  
AATGTGAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACCA
HKR336482 RBb41D10 pGCAP1 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR336504 RBb41E08 pGCAP1 NM_033022.3  
TTTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
HKR339211 RBb48A11 pGCAP1 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNTAACTA
HKR339260 RBb48C12 pGCAP1 NM_033022.3  
TGCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTA
HKR342083 RBb55D11 pGCAP1 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR343677 RBb59D05 pGCAP1 NM_033022.3  
TGGCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACT
HKR345329 RBb63F09 pGCAP1 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR363328 RBd08F08 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR364081 RBd10D09 pGCAP10 NM_033022.3  
GTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCAC
HKR364099 RBd10E03 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR364107 RBd10E11 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR364479 RBd11D07 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR365328 RBd13F08 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR368945 RBd22G01 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR371276 RBd28D04 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR371660 RBd29C12 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR374124 RBd35F04 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR374128 RBd35F08 pGCAP10 NM_033022.3  
TGCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTA
HKR375306 RBd38E10 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR379208 RBd48A08 pGCAP10 NM_033022.3  
GCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCC
HKR379305 RBd48E09 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR380548 RBd51G04 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR380834 RBd52B10 pGCAP10 NM_033022.3  
TCCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTA
HKR380921 RBd52F01 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR381204 RBd53A04 pGCAP10 NM_033022.3  
GCTTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATC
HKR381206 RBd53A06 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR383708 RBd59E12 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR386060 RBd65C12 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR388545 RBd71G01 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR390403 RBd76A03 pGCAP10 NM_033022.3  
GTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATC
HKR390806 RBd77A06 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR392860 RBd82C12 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR392879 RBd82D07 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR392905 RBd82E09 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR397235 RBd93B11 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR397651 RBd94C03 pGCAP10 NM_033022.3  
GGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGT
HKR405379 RBdS013H11 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR405410 RBdS013I18 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR406105 RBdS015E09 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR409074 RBdS022L10 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNAACTAT
HKR409168 RBdS022P08 pGCAP10 NM_033022.3  
GGTTCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAAC
HKR409175 RBdS022P15 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR416313 RBdS040N01 pGCAP10 NM_033022.3  
GCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCC
HKR430083 RBdS075D11 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR430242 RBdS075K02 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR433260 RBdS083C12 pGCAP10 NM_033022.3  
GAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACCAA
HKR442347 RBdS105O11 pGCAP10 NM_033022.3  
GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTAT
HKR462579 RBdS156H11 pGCAP10 NM_033022.3  
GGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl