Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022L10

Clone ID RBdS022L10
HP ID HP00365
Gene ID 6229
Gene Symbol RPS24
Protein Name ribosomal protein S24
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_033022.3
Length of RefSeq (bp) 671
Chromosome 10q22-q23
Reference DDBJ accession
UniGene Hs.280130
5'-terminal sequence GCTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGNAACTAT
2011.08.28