Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00357

HP ID(1) HP00357
Gene ID(2) 6227
Gene Symbol finder RPS21
Protein Name ribosomal protein S21
RefSeq NM_001024.3
Length of RefSeq (bp) 418
Chromosome 20q13.3
Reference DDBJ accession
UniGene Hs.190968

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05E05 pKA1U5 TGCTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAAC
ARe16F12 pKA1U5 GGCCCGCCGATATCTCTGCCGGGTGACTAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTG
ARe31E09 pKA1U5 GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
ARe38F12 pKA1U5 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
ARe45F06 pKA1U5 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
ARe54H08 pKA1U5 GCTCTCTCGCGCGCGGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCANAACGA
ARe74B08 pKA1U5 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
ARe74F08 pKA1U5 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
ARe85E02 pKA1U5 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
ARe88F01 pKA1U5 GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
ARe88H12 pKA1U5 GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
ARe96H09 pKA1U5 GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCATNCGCAGCCCAGCCTCGAAATGCAGA
ARi10G05 pGCAP10 GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
ARi14E11 pGCAP10 GCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
ARi19F01 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
ARi21G02 pGCAP10 GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
ARi33G03 pGCAP10 GCTCCTTGCCCGCCGATATCTCTGCCGGGTGACTAGCTGCTTCCTTTCTCTCTCGCGCGC
ARi35C04 pGCAP10 AGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAA
ARi36B02 pGCAP10 GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
ARi37D09 pGCAP10 AGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAA
ARi44C12 pGCAP10 GGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGACGCCGGCG
ARi55E02 pGCAP10 CGGCCGGCCGATGCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAA
ARiS023I21 pGCAP10 GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
ARiS049C22 pGCAP10 GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
ARiS085D21 pGCAP10 GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
ARiS085F03 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
ARiS118M12 pGCAP10 GGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGACGCCGGCG
ARiS122N14 pGCAP10 GCTTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATG
ARiS150J01 pGCAP10 CGGCCGGCCGATTGCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAG
ARiS150N23 pGCAP10 GTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCA
ARiS191P10 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
ARiS194P21 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
ARiS198K15 pGCAP10 GCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
ARiS198L07 pGCAP10 GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
RBb02B06 pKA1U5 GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
RBb03E05 pKA1U5 GCCCCTCCTTGCCCGCCGATATCTCTGCCGGGCGCAGCCCAGCCTCGAAATGCAGAACGA
RBb03F03 pKA1U5 TGGACCCGGAAGCGCTCGCCGAGGCCCCTCCTTGCCCGCCGATATCTCTGCCGGGTGACT
RBb06G05 pKA1U5 CTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAAC
RBb08H08 pKA1U5 GCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
RBb15C09 pKA1U5 GGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGACGCCGGCGAGTTCG
RBb16D02 pKA1U5 GGCCGATATCTCTGCCGGGTGACTAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGG
RBb24E01 pGCAP1 TGGAGCTTTTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAA
RBb28G06 pGCAP1 GGACTAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCC
RBb32C11 pGCAP1 GCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
RBb41F03 pGCAP1 GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
RBb51E09 pGCAP1 CTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGA
RBb62C09 pGCAP1
RBd04H03 pGCAP10 GCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGC
RBd10B09 pGCAP10 GGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGACGCCGGCGAGTT
RBd10C06 pGCAP10 GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
RBd13A01 pGCAP10 GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
RBd15E09 pGCAP10 GGACTAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCC
RBd18C11 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
RBd19B02 pGCAP10 GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
RBd26A08 pGCAP10 GCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
RBd34H07 pGCAP10 GCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
RBd37C09 pGCAP10 GCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGC
RBd38D07 pGCAP10 GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
RBd39B06 pGCAP10 GCCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAG
RBd40B11 pGCAP10 GTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCA
RBd42C06 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
RBd42G05 pGCAP10 GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
RBd42G06 pGCAP10 GAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGA
RBd45G11 pGCAP10 GGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGACGCCGGCGAGTTCG
RBd45H06 pGCAP10 GAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGA
RBd49C11 pGCAP10 GCTTTTTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATG
RBd50C02 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
RBd50E12 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
RBd56E01 pGCAP10 GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCNAAATGCAGAACGAC
RBd60C05 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
RBd62B12 pGCAP10 GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
RBd68H06 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
RBd83B05 pGCAP10 GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
RBdS013F12 pGCAP10 GCTTNNCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
RBdS013G19 pGCAP10 GNNANNCCGGNCGCGGNCTGGTGNCCGNAAGCCNNNCCNNGCCNCTNCNNNNGNANNNAC
RBdS013I23 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
RBdS014B05 pGCAP10 GCTTTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCA
RBdS014I06 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
RBdS015M18 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
RBdS051N07 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
RBdS070K09 pGCAP10 GGACTAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCC
RBdS075B15 pGCAP10 GCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
RBdS075E19 pGCAP10 GCTTTCNCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
RBdS083M10 pGCAP10 GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
RBdS105P06 pGCAP10 GGACTAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCC
RBdS110G23 pGCAP10 GCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGACGC
RBdS132F09 pGCAP10 CGGCCGGCCGATGCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCT
RBdS154H15 pGCAP10 GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl