Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105P06

Clone ID RBdS105P06
HP ID HP00357
Gene ID 6227
Gene Symbol RPS21
Protein Name ribosomal protein S21
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001024.3
Length of RefSeq (bp) 418
Chromosome 20q13.3
Reference DDBJ accession
UniGene Hs.190968
5'-terminal sequence GGACTAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCC
2011.08.28