Prev. |  KEGG KO K02971 > 

RIKEN DNA Bank Human Resource - RPS21

Gene ID NCBI Gene 6227 |  KEGG hsa:6227
Gene Symbol RPS21
Protein Name ribosomal protein S21
Synonyms HLDF|S21
Ortholog resources KEGG ortholog (KEGG orthology K02971) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008962 IRAK022G18 pCMV-SPORT6 BC018140 NM_001024 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042101 ARe05E05 pKA1U5 NM_001024.3  
TGCTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAAC
HKR046532 ARe16F12 pKA1U5 NM_001024.3  
GGCCCGCCGATATCTCTGCCGGGTGACTAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTG
HKR052505 ARe31E09 pKA1U5 NM_001024.3  
GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR055332 ARe38F12 pKA1U5 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR058126 ARe45F06 pKA1U5 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR061776 ARe54H08 pKA1U5 NM_001024.3  
GCTCTCTCGCGCGCGGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCANAACGA
HKR069632 ARe74B08 pKA1U5 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR069728 ARe74F08 pKA1U5 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR074098 ARe85E02 pKA1U5 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR075321 ARe88F01 pKA1U5 NM_001024.3  
GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
HKR075380 ARe88H12 pKA1U5 NM_001024.3  
GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
HKR078577 ARe96H09 pKA1U5 NM_001024.3  
GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCATNCGCAGCCCAGCCTCGAAATGCAGA
HKR164149 ARi10G05 pGCAP10 NM_001024.3  
GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
HKR165707 ARi14E11 pGCAP10 NM_001024.3  
GCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR167721 ARi19F01 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR168546 ARi21G02 pGCAP10 NM_001024.3  
GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
HKR173347 ARi33G03 pGCAP10 NM_001024.3  
GCTCCTTGCCCGCCGATATCTCTGCCGGGTGACTAGCTGCTTCCTTTCTCTCTCGCGCGC
HKR174052 ARi35C04 pGCAP10 NM_001024.3  
AGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAA
HKR174426 ARi36B02 pGCAP10 NM_001024.3  
GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
HKR174881 ARi37D09 pGCAP10 NM_001024.3  
AGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAA
HKR177660 ARi44C12 pGCAP10 NM_001024.3  
GGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGACGCCGGCG
HKR182098 ARi55E02 pGCAP10 NM_001024.3  
CGGCCGGCCGATGCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAA
HKR209413 ARiS023I21 pGCAP10 NM_001024.3  
GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR219670 ARiS049C22 pGCAP10 NM_001024.3  
GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
HKR234093 ARiS085D21 pGCAP10 NM_001024.3  
GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR234123 ARiS085F03 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR247500 ARiS118M12 pGCAP10 NM_001024.3  
GGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGACGCCGGCG
HKR249126 ARiS122N14 pGCAP10 NM_001024.3  
GCTTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATG
HKR260217 ARiS150J01 pGCAP10 NM_001024.3  
CGGCCGGCCGATTGCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAG
HKR260335 ARiS150N23 pGCAP10 NM_001024.3  
GTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCA
HKR276770 ARiS191P10 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR277981 ARiS194P21 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR279455 ARiS198K15 pGCAP10 NM_001024.3  
GCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR279471 ARiS198L07 pGCAP10 NM_001024.3  
GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR320830 RBb02B06 pKA1U5 NM_001024.3  
GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
HKR321301 RBb03E05 pKA1U5 NM_001024.3  
GCCCCTCCTTGCCCGCCGATATCTCTGCCGGGCGCAGCCCAGCCTCGAAATGCAGAACGA
HKR321323 RBb03F03 pKA1U5 NM_001024.3  
TGGACCCGGAAGCGCTCGCCGAGGCCCCTCCTTGCCCGCCGATATCTCTGCCGGGTGACT
HKR322549 RBb06G05 pKA1U5 NM_001024.3  
CTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAAC
HKR323376 RBb08H08 pKA1U5 NM_001024.3  
GCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR326057 RBb15C09 pKA1U5 NM_001024.3  
GGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGACGCCGGCGAGTTCG
HKR326474 RBb16D02 pKA1U5 NM_001024.3  
GGCCGATATCTCTGCCGGGTGACTAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGG
HKR329697 RBb24E01 pGCAP1 NM_001024.3  
TGGAGCTTTTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAA
HKR331350 RBb28G06 pGCAP1 NM_001024.3  
GGACTAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCC
HKR332859 RBb32C11 pGCAP1 NM_001024.3  
GCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR336523 RBb41F03 pGCAP1 NM_001024.3  
GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
HKR340505 RBb51E09 pGCAP1 NM_001024.3  
CTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGA
HKR344857 RBb62C09 pGCAP1 NM_001024.3  
HKR361771 RBd04H03 pGCAP10 NM_001024.3  
GCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGC
HKR364033 RBd10B09 pGCAP10 NM_001024.3  
GGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGACGCCGGCGAGTT
HKR364054 RBd10C06 pGCAP10 NM_001024.3  
GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
HKR365201 RBd13A01 pGCAP10 NM_001024.3  
GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
HKR366105 RBd15E09 pGCAP10 NM_001024.3  
GGACTAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCC
HKR367259 RBd18C11 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR367626 RBd19B02 pGCAP10 NM_001024.3  
GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR370408 RBd26A08 pGCAP10 NM_001024.3  
GCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR373775 RBd34H07 pGCAP10 NM_001024.3  
GCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR374857 RBd37C09 pGCAP10 NM_001024.3  
GCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGC
HKR375279 RBd38D07 pGCAP10 NM_001024.3  
GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR375630 RBd39B06 pGCAP10 NM_001024.3  
GCCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAG
HKR376035 RBd40B11 pGCAP10 NM_001024.3  
GTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCA
HKR376854 RBd42C06 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR376949 RBd42G05 pGCAP10 NM_001024.3  
GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGAC
HKR376950 RBd42G06 pGCAP10 NM_001024.3  
GAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGA
HKR378155 RBd45G11 pGCAP10 NM_001024.3  
GGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGACGCCGGCGAGTTCG
HKR378174 RBd45H06 pGCAP10 NM_001024.3  
GAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGA
HKR379659 RBd49C11 pGCAP10 NM_001024.3  
GCTTTTTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATG
HKR380050 RBd50C02 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR380108 RBd50E12 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR382497 RBd56E01 pGCAP10 NM_001024.3  
GCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCNAAATGCAGAACGAC
HKR384053 RBd60C05 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR384836 RBd62B12 pGCAP10 NM_001024.3  
GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR387374 RBd68H06 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR393229 RBd83B05 pGCAP10 NM_001024.3  
GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR405332 RBdS013F12 pGCAP10 NM_001024.3  
GCTTNNCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR405363 RBdS013G19 pGCAP10 NM_001024.3  
GNNANNCCGGNCGCGGNCTGGTGNCCGNAAGCCNNNCCNNGCCNCTNCNNNNGNANNNAC
HKR405415 RBdS013I23 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR405629 RBdS014B05 pGCAP10 NM_001024.3  
GCTTTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCA
HKR405798 RBdS014I06 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR406306 RBdS015M18 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR420719 RBdS051N07 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR428249 RBdS070K09 pGCAP10 NM_001024.3  
GGACTAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCC
HKR430039 RBdS075B15 pGCAP10 NM_001024.3  
GCTTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA
HKR430115 RBdS075E19 pGCAP10 NM_001024.3  
GCTTTCNCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR433498 RBdS083M10 pGCAP10 NM_001024.3  
GCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAA
HKR442366 RBdS105P06 pGCAP10 NM_001024.3  
GGACTAGCTGCTTCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCC
HKR444167 RBdS110G23 pGCAP10 NM_001024.3  
GCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGACGC
HKR452929 RBdS132F09 pGCAP10 NM_001024.3  
CGGCCGGCCGATGCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCT
HKR461783 RBdS154H15 pGCAP10 NM_001024.3  
GCCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl