Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00348

HP ID(1) HP00348
Gene ID(2) 6132
Gene Symbol finder RPL8
Protein Name ribosomal protein L8
RefSeq NM_000973.3
Length of RefSeq (bp) 903
Chromosome 8q24.3
Reference DDBJ accession
UniGene Hs.178551

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe10H11 pKA1U5 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARe14C02 pKA1U5 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGAC
ARe23H11 pKA1U5 GTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTTNNCCATGGGCCGTGTGATCCGTGG
ARe31H10 pKA1U5 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGAC
ARe32D03 pKA1U5 GCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGA
ARe34D06 pKA1U5 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGAC
ARe37C10 pKA1U5 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARe42G04 pKA1U5 GGTCATCCTTGCGGCCTTGCGGCATGGGCAGTATCNTCCGCCATCCTCTTCCGTGAGGCG
ARe47A10 pKA1U5 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGAC
ARe53G09 pKA1U5 GCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGA
ARe57B09 pKA1U5 TGCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGA
ARe60A10 pKA1U5 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGAC
ARe65C09 pKA1U5 ATCCTGGGTTTCCTCTTTCGGCCGCGCTGGTGAACATTGACCCGNTCGCCATGGGCCGTG
ARe74A06 pKA1U5 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGAC
ARe74D08 pKA1U5 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGGGATCCGTGGAC
ARe80H03 pKA1U5 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARe89D08 pKA1U5 TGCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
ARe91F09 pKA1U5 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARe96C08 pKA1U5 GTCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
ARe96D04 pKA1U5 GTCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
ARf05C02 pKA1U5 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARf07H06 pKA1U5 GCTCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGG
ARi05C03 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARi09A02 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARi09G09 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARi18D07 pGCAP10 GTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACAG
ARi22G07 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARi27G08 pGCAP10 GCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACAGA
ARi33G02 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARi36B08 pGCAP10 TCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACAGA
ARi44C06 pGCAP10 TGCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
ARi52H02 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARi56B08 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARi62D04 pGCAP10 GCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGNAC
ARiS008E06 pGCAP10 GGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACAGAGGAAG
ARiS008P20 pGCAP10 GCTCTTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGG
ARiS055H01 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARiS085M12 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARiS096J21 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARiS096L01 pGCAP10 GCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
ARiS118E16 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARiS118H18 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARiS118M09 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
ARiS150E17 pGCAP10 GTCTTNNNNNCNCGCTGGNNAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACAG
ARiS161H12 pGCAP10 GGTTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCG
ARiS194C10 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
RBb05A10 pKA1U5 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGAC
RBb13H02 pKA1U5 ATGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCG
RBb15G12 pKA1U5 GTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACAG
RBb42E08 pGCAP1 GCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
RBb55A02 pGCAP1 GGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGT
RBd24H11 pGCAP10 GTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGA
RBd30A08 pGCAP10 GCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACAGA
RBd61B10 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
RBd74E03 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
RBd85F07 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
RBd87B10 pGCAP10 GGCCCCGGAAGATAAGGCCGCTCGCTGACGCCGTGTTTCCTCTTTCGGCCGCGCTGGTGA
RBd97E10 pGCAP10 CGCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
RBdS013F17 pGCAP10 GGTGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCC
RBdS015J05 pGCAP10 TGCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
RBdS022F13 pGCAP10 TGGGCTCGCTGACGCCATGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCA
RBdS040B14 pGCAP10 GGCTCGCTGACGCCATGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATG
RBdS177A22 pGCAP10 GTGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCG
RBdS177K10 pGCAP10 GGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGT
RBdS177M08 pGCAP10 GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl