Prev. |  KEGG KO K02938 > 

RIKEN DNA Bank Human Resource - RPL8

Gene ID NCBI Gene 6132 |  KEGG hsa:6132
Gene Symbol RPL8
Protein Name ribosomal protein L8
Synonyms L8
Ortholog resources KEGG ortholog (KEGG orthology K02938) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010530 IRAK026F10 pCMV-SPORT6 BC013104 NM_033301 Full/var
HGY082817 IRAL007A17 pOTB7 BC000047 NM_033301 Partial
HGY082939 IRAL007F19 pOTB7 BC000077 NM_033301 Full
HGY083770 IRAL009H02 pOTB7 BC012197 NM_033301 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044179 ARe10H11 pKA1U5 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR045650 ARe14C02 pKA1U5 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGAC
HKR049379 ARe23H11 pKA1U5 NM_000973.3  
GTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTTNNCCATGGGCCGTGTGATCCGTGG
HKR052578 ARe31H10 pKA1U5 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGAC
HKR052875 ARe32D03 pKA1U5 NM_000973.3  
GCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGA
HKR053678 ARe34D06 pKA1U5 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGAC
HKR054858 ARe37C10 pKA1U5 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR056948 ARe42G04 pKA1U5 NM_000973.3  
GGTCATCCTTGCGGCCTTGCGGCATGGGCAGTATCNTCCGCCATCCTCTTCCGTGAGGCG
HKR058810 ARe47A10 pKA1U5 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGAC
HKR061353 ARe53G09 pKA1U5 NM_000973.3  
GCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGA
HKR062833 ARe57B09 pKA1U5 NM_000973.3  
TGCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGA
HKR064010 ARe60A10 pKA1U5 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGAC
HKR066057 ARe65C09 pKA1U5 NM_000973.3  
ATCCTGGGTTTCCTCTTTCGGCCGCGCTGGTGAACATTGACCCGNTCGCCATGGGCCGTG
HKR069606 ARe74A06 pKA1U5 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGAC
HKR069680 ARe74D08 pKA1U5 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGGGATCCGTGGAC
HKR072171 ARe80H03 pKA1U5 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR075680 ARe89D08 pKA1U5 NM_000973.3  
TGCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
HKR076529 ARe91F09 pKA1U5 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR078456 ARe96C08 pKA1U5 NM_000973.3  
GTCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
HKR078476 ARe96D04 pKA1U5 NM_000973.3  
GTCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
HKR082050 ARf05C02 pKA1U5 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR082974 ARf07H06 pKA1U5 NM_000973.3  
GCTCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGG
HKR162051 ARi05C03 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR163602 ARi09A02 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR163753 ARi09G09 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR167279 ARi18D07 pGCAP10 NM_000973.3  
GTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACAG
HKR168951 ARi22G07 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR170952 ARi27G08 pGCAP10 NM_000973.3  
GCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACAGA
HKR173346 ARi33G02 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR174432 ARi36B08 pGCAP10 NM_000973.3  
TCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACAGA
HKR177654 ARi44C06 pGCAP10 NM_000973.3  
TGCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
HKR180970 ARi52H02 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR182432 ARi56B08 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR184876 ARi62D04 pGCAP10 NM_000973.3  
GCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGNAC
HKR203302 ARiS008E06 pGCAP10 NM_000973.3  
GGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACAGAGGAAG
HKR203580 ARiS008P20 pGCAP10 NM_000973.3  
GCTCTTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGG
HKR222169 ARiS055H01 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR234300 ARiS085M12 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR238637 ARiS096J21 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR238665 ARiS096L01 pGCAP10 NM_000973.3  
GCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
HKR247312 ARiS118E16 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR247386 ARiS118H18 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR247497 ARiS118M09 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR260113 ARiS150E17 pGCAP10 NM_000973.3  
GTCTTNNNNNCNCGCTGGNNAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACAG
HKR264580 ARiS161H12 pGCAP10 NM_000973.3  
GGTTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCG
HKR277658 ARiS194C10 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR322010 RBb05A10 pKA1U5 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGCTCGCCATGGGCCGTGTGATCCGTGGAC
HKR325370 RBb13H02 pKA1U5 NM_000973.3  
ATGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCG
HKR326156 RBb15G12 pKA1U5 NM_000973.3  
GTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACAG
HKR336904 RBb42E08 pGCAP1 NM_000973.3  
GCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
HKR342002 RBb55A02 pGCAP1 NM_000973.3  
GGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGT
HKR369779 RBd24H11 pGCAP10 NM_000973.3  
GTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGA
HKR372008 RBd30A08 pGCAP10 NM_000973.3  
GCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACAGA
HKR384434 RBd61B10 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR389699 RBd74E03 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR394127 RBd85F07 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA
HKR394834 RBd87B10 pGCAP10 NM_000973.3  
GGCCCCGGAAGATAAGGCCGCTCGCTGACGCCGTGTTTCCTCTTTCGGCCGCGCTGGTGA
HKR398906 RBd97E10 pGCAP10 NM_000973.3  
CGCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
HKR405337 RBdS013F17 pGCAP10 NM_000973.3  
GGTGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCC
HKR406221 RBdS015J05 pGCAP10 NM_000973.3  
TGCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGAC
HKR408933 RBdS022F13 pGCAP10 NM_000973.3  
TGGGCTCGCTGACGCCATGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCA
HKR416038 RBdS040B14 pGCAP10 NM_000973.3  
GGCTCGCTGACGCCATGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATG
HKR470822 RBdS177A22 pGCAP10 NM_000973.3  
GTGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCG
HKR471050 RBdS177K10 pGCAP10 NM_000973.3  
GGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGT
HKR471096 RBdS177M08 pGCAP10 NM_000973.3  
GCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCGTGGACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl