Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177A22

Clone ID RBdS177A22
HP ID HP00348
Gene ID 6132
Gene Symbol RPL8
Protein Name ribosomal protein L8
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000973.3
Length of RefSeq (bp) 903
Chromosome 8q24.3
Reference DDBJ accession
UniGene Hs.178551
5'-terminal sequence GTGTTTCCTCTTTCGGCCGCGCTGGTGAACAGGACCCGTCGCCATGGGCCGTGTGATCCG
2011.08.28