Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00319

HP ID(1) HP00319
Gene ID(2) 6134
Gene Symbol finder RPL10
Protein Name ribosomal protein L10
RefSeq NM_006013.2
Length of RefSeq (bp) 744
Chromosome Xq28
Reference DDBJ accession
UniGene Hs.534404

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01E08 pKA1U5 GCTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
ARe03G05 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe08H01 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTTGTCGCCATGGGCCGCCGCCCCGC
ARe11D03 pKA1U5 GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTTGTCGCCATGGGCCGCCGCCCCG
ARe11F02 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe17G10 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe18C04 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe18G01 pKA1U5 TTGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
ARe21D09 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe22F03 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe26F09 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe32H02 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe33F08 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe34A05 pKA1U5 ATCCTGGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGC
ARe34E03 pKA1U5 GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTTGTCGCCATGGGCCGCCGCCCCG
ARe35E07 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe36D12 pKA1U5 TGCTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCC
ARe37C08 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe37G02 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTTGTCGCCATGGGCCGCCGCCCCGC
ARe39F03 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe42A01 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe43E03 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTTCGCCATGGGCCGCCGCCCCGC
ARe43E05 pKA1U5 GCTTCTTTTCCCTTCCGCGGTGGNGCCACATGCAAGGATCCACNNCTTTCGCCATGGGCC
ARe45B11 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe53B03 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGCTGTCGCCATGGGCCGCCGCCCCGC
ARe59F11 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe60E02 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGGAANATNCTGGTGTNNNCATGGNCCGCCGCCCCGC
ARe64B07 pKA1U5 GCTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
ARe66H05 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe67B01 pKA1U5 GCTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
ARe67E09 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe69A04 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe69B11 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe73A04 pKA1U5 GCTCTTTCCCTTCGGATGTTGGATAAGNAAGCGCAGCNTGTTCNANCTCTTGCGGTGCCG
ARe76A08 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTTGTTCGCCATGGGCCGCCGCCCCG
ARe77E07 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCCCGGTTGATCGCCATGGGCCGCCGCCCC
ARe77G10 pKA1U5 GGCGGGTGGCTGTGCTGGTGGCGTTCAAGATGCCGTCCAAGAATTTCCGAGTCAGTGACG
ARe78B08 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe78F03 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe79G07 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe81H06 pKA1U5 GAGGTGGATTTAGTGCCACGNTGCCCGAAAGTCTTAAATTGGGTGACCTGAGCTGTGCAA
ARe84G08 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARe85B06 pKA1U5 TGAGGACTCTATGGTTCTTACGCGCGCAGACAGACCGCCTATATAAGCCATGCGCAGGCG
ARe85D01 pKA1U5 GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
ARe97E02 pKA1U5 GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
ARf02B08 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARf03C12 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi06B07 pGCAP10 TGAAGACATGGTGGCTGAAAAGCGGCTCATCCCAGATGGCTGTGGGGTCAAGTACATCCC
ARi07C10 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi08G10 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi14F08 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi16A06 pGCAP10 TGAAGACATGGTGGCTGAAAAGCGGCTCATCCCANATGGCTGTGGGGTCAAGTACATCCC
ARi17A01 pGCAP10 GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
ARi18E03 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi18F04 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi19F03 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi20F10 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi20H11 pGCAP10 TGAAGACATGGTGGCTGAAAAGCGGCTCATCCCAGATGGCTGTGGGGTCAAGTACATCCC
ARi27H07 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi28D07 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi40H04 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi44A10 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi44F02 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi54A03 pGCAP10 GCTCTTTCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCCGCC
ARi54E09 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi57H11 pGCAP10 GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
ARi65A02 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARi65E01 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGNCCGCCGCCCCGCCC
ARi65E08 pGCAP10 GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
ARi69D12 pGCAP10 GCNCAAGCGNACGGGGNGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
ARiS008F19 pGCAP10 GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
ARiS008I23 pGCAP10 CCTCTTTCCCTTCNGNGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS008L19 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS013O05 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS020N23 pGCAP10 GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
ARiS020O21 pGCAP10 GCTCTTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
ARiS023O23 pGCAP10 GNTCTTTCCCTTCGGTGTGCNNNTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS023P04 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS055G22 pGCAP10 TGAANACATGGTGGCTGAAAAGCGGGCTCATCCCANATGGCTGTGGGGTCAAGTACATCC
ARiS055M01 pGCAP10 CGGCCGGCCGATGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGC
ARiS085F12 pGCAP10 CGGCCGGCCGATTAAGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATG
ARiS087D14 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS087O14 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS088C21 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS088E16 pGCAP10 GCTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
ARiS088F07 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS088P21 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS096D19 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS096N01 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS096O17 pGCAP10 CCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS109L06 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS122D21 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS122N15 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS150H12 pGCAP10 GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
ARiS150P15 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS161C13 pGCAP10 GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
ARiS161D21 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS161N05 pGCAP10 TGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
ARiS191E07 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
ARiS198O23 pGCAP10 GCTNNNNNCCTNCGGNNGCCACNGAANANNCNGGNGTCGCCANGGGCCGCCGCCCCGCCC
RBb11B11 pKA1U5 GCTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
RBb14A01 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGNTGATCGCCATGGGCCGCCGCCCCG
RBb15G03 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTTGNTCGCCATGGGCCGCCGCCCCG
RBb18G06 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTTCGCCATGGGCCGCCGCCCCGC
RBb20C05 pKA1U5 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBb21B02 pKA1U5 GCTCTTTCCCTTCGGTGTGGTGACCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCC
RBb23D11 pGCAP1 TTGTCTTTCCCTTCGGTGTTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
RBb26F06 pGCAP1 TGTTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
RBb26G04 pGCAP1 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBb29E03 pGCAP1 AAATGTGGTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCC
RBb29H10 pGCAP1 TTTTTTTTTTTTTTGGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATG
RBb31A08 pGCAP1
RBb34E11 pGCAP1 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBb45B04 pGCAP1 TTGTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGAGTCGCCATGGGCCGCCGCCCC
RBb59D08 pGCAP1 GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
RBb61C10 pGCAP1 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBb63C06 pGCAP1 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBb63C12 pGCAP1 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBb63E10 pGCAP1 CTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
RBb67B03 pGCAP1 TCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBb69E02 pGCAP1
RBb70B12 pGCAP1 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd02C09 pGCAP10 TTCTCTTTCCCCTTCGGAGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
RBd04B10 pGCAP10 GCTCTTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
RBd14A05 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd16G02 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd18B06 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd19C02 pGCAP10 GCTCTTTCCCTTCGGTGTGGTGAGTAAGCGCAGTTGTCGTCTCTTGCGGTGCCGTTGCTG
RBd20E06 pGCAP10 GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
RBd20E10 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd20H03 pGCAP10 GAGTTGTCGTCTCTTGCGGTGCCGTTGCTGGTTCTCACACCTTTTAGGTCTGTTCTCGTC
RBd21B12 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd21H11 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd25E08 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd26E01 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd31G12 pGCAP10 TGCTCTTTCCCTTCCGTGTGCCACTGAAGATCCTGGAGTCTGCATGGGCCGCCGCCCCCC
RBd34E07 pGCAP10 GATTCGCATTTTTGACCTGGGGCGGAAAAAGGCAAAAGTGGATGAGTTTCCGCTTTGTGG
RBd37B01 pGCAP10 TGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
RBd46D07 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd47B05 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd48B01 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd48G07 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd51E09 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd51F09 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd52E02 pGCAP10 GATATAAGCCATGCGCAGGCGGAGGAGCGCCTCTTTCCCTTCGGTGTGCCACTGAAGATC
RBd56D10 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd58H03 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCNNNNNCCGCCGCCCCGCC
RBd60C10 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd60E05 pGCAP10 GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
RBd63H05 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd64G08 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd67A05 pGCAP10 GCTCTTTCCCTTCGGTGTGGTGAGTAAGCGCAGTTGTCGTCTCTTGCGGTGCCGTTGCTG
RBd68H05 pGCAP10 GCTCTTTCCCTTCGGTGTGGTGAGTAAGCGCAGTTGTCGTCTCTTGCGGTGCCGTTGCTG
RBd74A01 pGCAP10 GGAAAGTCTTAAATTGGGTGACCTGAGCTGTGCAATGATAATGCGGCGATTTTGTAGTAC
RBd74D10 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd75G04 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd76H04 pGCAP10 GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
RBd79C10 pGCAP10 GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
RBd81E01 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd83B06 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd89A02 pGCAP10 GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
RBd93B02 pGCAP10 GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
RBd94A04 pGCAP10 GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
RBd94B12 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd97E07 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd97G04 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBd98A10 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS007E24 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS007M06 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS013B24 pGCAP10 GCTCTTTCCCTTCGGTGTGGTGAGTAAGCGCAGTTGTCGTCTCTTGCGGTGCCGTTGCTG
RBdS013C11 pGCAP10 GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
RBdS014E01 pGCAP10 GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
RBdS014F22 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS015G13 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS015I03 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS015J06 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS015M17 pGCAP10 GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
RBdS022L07 pGCAP10 GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
RBdS022N07 pGCAP10 ATGTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
RBdS040D23 pGCAP10 GCNCTTTCCCTNNCNNATGNCCNTCAGGATNNCGGGGTCNNCCTGGGCCNGCACNNCNCC
RBdS040M07 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS051O10 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS070I01 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS070J20 pGCAP10 GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
RBdS075P05 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS081C20 pGCAP10 GCTCTTTCCCTTCGGTGTGGTGAGTAAGCGCAGTTGTCGTCTCTTGCGGTGCCGTTGCTG
RBdS081N07 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS083B17 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS083N11 pGCAP10 TGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
RBdS104L18 pGCAP10 CCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS104L24 pGCAP10 GCTTTTCCCTTCGGTGTGGTGAGTAAGCGCAGTTGTCGTCTCTTGCGGTGCCGTTGCTGG
RBdS105H13 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS105L23 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS110A13 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS110I17 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS110K17 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS132N04 pGCAP10 GAGGACTCTATGGTTCTTACGCGCGCAGACAGACCGCCTATATAAGCCATGCGCAGGCGG
RBdS154K13 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
RBdS177M19 pGCAP10 GNCCNTNCCCTNCTTTGCNCCTCNCNNNNNNCTGGNGTCACCNTGNGCCGNCGCTNANGT
RBdS187N16 pGCAP10 GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
RBdS187M22 pGCAP10 GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl