Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110K17

Clone ID RBdS110K17
HP ID HP00319
Gene ID 6134
Gene Symbol RPL10
Protein Name ribosomal protein L10
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006013.2
Length of RefSeq (bp) 744
Chromosome Xq28
Reference DDBJ accession
UniGene Hs.534404
5'-terminal sequence GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
2011.08.28