Prev. |  KEGG KO K02866 > 

RIKEN DNA Bank Human Resource - RPL10

Gene ID NCBI Gene 6134 |  KEGG hsa:6134
Gene Symbol RPL10
Protein Name ribosomal protein L10
Synonyms AUTSX5|DXS648|DXS648E|L10|MRXS35|NOV|QM
Ortholog resources KEGG ortholog (KEGG orthology K02866) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001255 IRAK003C07 pCMV-SPORT6 BC003358 NM_006013 Full
HGY094234 IRAL035J18 pDNR-LIB BC026276 NM_006013 Full
HGY103563 IRAL058P03 pOTB7 BC071918 NM_006013 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040504 ARe01E08 pKA1U5 NM_006013.2  
GCTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
HKR041349 ARe03G05 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR043369 ARe08H01 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTTGTCGCCATGGGCCGCCGCCCCGC
HKR044475 ARe11D03 pKA1U5 NM_006013.2  
GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTTGTCGCCATGGGCCGCCGCCCCG
HKR044522 ARe11F02 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR046954 ARe17G10 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR047252 ARe18C04 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR047345 ARe18G01 pKA1U5 NM_006013.2  
TTGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
HKR048481 ARe21D09 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR048923 ARe22F03 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR050529 ARe26F09 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR052970 ARe32H02 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR053328 ARe33F08 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR053605 ARe34A05 pKA1U5 NM_006013.2  
ATCCTGGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGC
HKR053699 ARe34E03 pKA1U5 NM_006013.2  
GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTTGTCGCCATGGGCCGCCGCCCCG
HKR054103 ARe35E07 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR054484 ARe36D12 pKA1U5 NM_006013.2  
TGCTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCC
HKR054856 ARe37C08 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR054946 ARe37G02 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTTGTCGCCATGGGCCGCCGCCCCGC
HKR055723 ARe39F03 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR056801 ARe42A01 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR057299 ARe43E03 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTTCGCCATGGGCCGCCGCCCCGC
HKR057301 ARe43E05 pKA1U5 NM_006013.2  
GCTTCTTTTCCCTTCCGCGGTGGNGCCACATGCAAGGATCCACNNCTTTCGCCATGGGCC
HKR058035 ARe45B11 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR061227 ARe53B03 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGCTGTCGCCATGGGCCGCCGCCCCGC
HKR063731 ARe59F11 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR064098 ARe60E02 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGGAANATNCTGGTGTNNNCATGGNCCGCCGCCCCGC
HKR065631 ARe64B07 pKA1U5 NM_006013.2  
GCTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
HKR066573 ARe66H05 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR066825 ARe67B01 pKA1U5 NM_006013.2  
GCTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
HKR066905 ARe67E09 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR067604 ARe69A04 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR067635 ARe69B11 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR069204 ARe73A04 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGATGTTGGATAAGNAAGCGCAGCNTGTTCNANCTCTTGCGGTGCCG
HKR070408 ARe76A08 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTTGTTCGCCATGGGCCGCCGCCCCG
HKR070903 ARe77E07 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCCCGGTTGATCGCCATGGGCCGCCGCCCC
HKR070954 ARe77G10 pKA1U5 NM_006013.2  
GGCGGGTGGCTGTGCTGGTGGCGTTCAAGATGCCGTCCAAGAATTTCCGAGTCAGTGACG
HKR071232 ARe78B08 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR071323 ARe78F03 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR071751 ARe79G07 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR072574 ARe81H06 pKA1U5 NM_006013.2  
GAGGTGGATTTAGTGCCACGNTGCCCGAAAGTCTTAAATTGGGTGACCTGAGCTGTGCAA
HKR073752 ARe84G08 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR074030 ARe85B06 pKA1U5 NM_006013.2  
TGAGGACTCTATGGTTCTTACGCGCGCAGACAGACCGCCTATATAAGCCATGCGCAGGCG
HKR074073 ARe85D01 pKA1U5 NM_006013.2  
GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR078898 ARe97E02 pKA1U5 NM_006013.2  
GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR080832 ARf02B08 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR081260 ARf03C12 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR162431 ARi06B07 pGCAP10 NM_006013.2  
TGAAGACATGGTGGCTGAAAAGCGGCTCATCCCAGATGGCTGTGGGGTCAAGTACATCCC
HKR162858 ARi07C10 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR163354 ARi08G10 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR165728 ARi14F08 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR166406 ARi16A06 pGCAP10 NM_006013.2  
TGAAGACATGGTGGCTGAAAAGCGGCTCATCCCANATGGCTGTGGGGTCAAGTACATCCC
HKR166801 ARi17A01 pGCAP10 NM_006013.2  
GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR167299 ARi18E03 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR167324 ARi18F04 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR167723 ARi19F03 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR168130 ARi20F10 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR168179 ARi20H11 pGCAP10 NM_006013.2  
TGAAGACATGGTGGCTGAAAAGCGGCTCATCCCAGATGGCTGTGGGGTCAAGTACATCCC
HKR170975 ARi27H07 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR171279 ARi28D07 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR176172 ARi40H04 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR177610 ARi44A10 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR177722 ARi44F02 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR181603 ARi54A03 pGCAP10 NM_006013.2  
GCTCTTTCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCCGCC
HKR181705 ARi54E09 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR182979 ARi57H11 pGCAP10 NM_006013.2  
GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR186002 ARi65A02 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR186097 ARi65E01 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGNCCGCCGCCCCGCCC
HKR186104 ARi65E08 pGCAP10 NM_006013.2  
GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR187684 ARi69D12 pGCAP10 NM_006013.2  
GCNCAAGCGNACGGGGNGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR203339 ARiS008F19 pGCAP10 NM_006013.2  
GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR203415 ARiS008I23 pGCAP10 NM_006013.2  
CCTCTTTCCCTTCNGNGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR203483 ARiS008L19 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR205541 ARiS013O05 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR208335 ARiS020N23 pGCAP10 NM_006013.2  
GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR208357 ARiS020O21 pGCAP10 NM_006013.2  
GCTCTTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR209559 ARiS023O23 pGCAP10 NM_006013.2  
GNTCTTTCCCTTCGGTGTGCNNNTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR209564 ARiS023P04 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR222166 ARiS055G22 pGCAP10 NM_006013.2  
TGAANACATGGTGGCTGAAAAGCGGGCTCATCCCANATGGCTGTGGGGTCAAGTACATCC
HKR222289 ARiS055M01 pGCAP10 NM_006013.2  
CGGCCGGCCGATGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGC
HKR234132 ARiS085F12 pGCAP10 NM_006013.2  
CGGCCGGCCGATTAAGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATG
HKR234886 ARiS087D14 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR235150 ARiS087O14 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR235269 ARiS088C21 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR235312 ARiS088E16 pGCAP10 NM_006013.2  
GCTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
HKR235327 ARiS088F07 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR235581 ARiS088P21 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR238491 ARiS096D19 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR238713 ARiS096N01 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR238753 ARiS096O17 pGCAP10 NM_006013.2  
CCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR243870 ARiS109L06 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR248893 ARiS122D21 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR249127 ARiS122N15 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR260180 ARiS150H12 pGCAP10 NM_006013.2  
GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR260375 ARiS150P15 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR264461 ARiS161C13 pGCAP10 NM_006013.2  
GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR264493 ARiS161D21 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR264717 ARiS161N05 pGCAP10 NM_006013.2  
TGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR276503 ARiS191E07 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR279559 ARiS198O23 pGCAP10 NM_006013.2  
GCTNNNNNCCTNCGGNNGCCACNGAANANNCNGGNGTCGCCANGGGCCGCCGCCCCGCCC
HKR324435 RBb11B11 pKA1U5 NM_006013.2  
GCTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
HKR325601 RBb14A01 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGNTGATCGCCATGGGCCGCCGCCCCG
HKR326147 RBb15G03 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTTGNTCGCCATGGGCCGCCGCCCCG
HKR327350 RBb18G06 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTTCGCCATGGGCCGCCGCCCCGC
HKR328053 RBb20C05 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR328426 RBb21B02 pKA1U5 NM_006013.2  
GCTCTTTCCCTTCGGTGTGGTGACCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCC
HKR329283 RBb23D11 pGCAP1 NM_006013.2  
TTGTCTTTCCCTTCGGTGTTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
HKR330526 RBb26F06 pGCAP1 NM_006013.2  
TGTTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR330548 RBb26G04 pGCAP1 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR331699 RBb29E03 pGCAP1 NM_006013.2  
AAATGTGGTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCC
HKR331778 RBb29H10 pGCAP1 NM_006013.2  
TTTTTTTTTTTTTTGGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATG
HKR332408 RBb31A08 pGCAP1 NM_006013.2  
HKR333707 RBb34E11 pGCAP1 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR338028 RBb45B04 pGCAP1 NM_006013.2  
TTGTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGAGTCGCCATGGGCCGCCGCCCC
HKR343680 RBb59D08 pGCAP1 NM_006013.2  
GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR344458 RBb61C10 pGCAP1 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR345254 RBb63C06 pGCAP1 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR345260 RBb63C12 pGCAP1 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR345306 RBb63E10 pGCAP1 NM_006013.2  
CTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR346827 RBb67B03 pGCAP1 NM_006013.2  
TCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR347698 RBb69E02 pGCAP1 NM_006013.2  
HKR348036 RBb70B12 pGCAP1 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR360857 RBd02C09 pGCAP10 NM_006013.2  
TTCTCTTTCCCCTTCGGAGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCG
HKR361634 RBd04B10 pGCAP10 NM_006013.2  
GCTCTTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR365605 RBd14A05 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR366546 RBd16G02 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR367230 RBd18B06 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR367650 RBd19C02 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGGTGAGTAAGCGCAGTTGTCGTCTCTTGCGGTGCCGTTGCTG
HKR368102 RBd20E06 pGCAP10 NM_006013.2  
GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR368106 RBd20E10 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR368171 RBd20H03 pGCAP10 NM_006013.2  
GAGTTGTCGTCTCTTGCGGTGCCGTTGCTGGTTCTCACACCTTTTAGGTCTGTTCTCGTC
HKR368436 RBd21B12 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR368579 RBd21H11 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR370104 RBd25E08 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR370497 RBd26E01 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR372556 RBd31G12 pGCAP10 NM_006013.2  
TGCTCTTTCCCTTCCGTGTGCCACTGAAGATCCTGGAGTCTGCATGGGCCGCCGCCCCCC
HKR373703 RBd34E07 pGCAP10 NM_006013.2  
GATTCGCATTTTTGACCTGGGGCGGAAAAAGGCAAAAGTGGATGAGTTTCCGCTTTGTGG
HKR374825 RBd37B01 pGCAP10 NM_006013.2  
TGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR378479 RBd46D07 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR378829 RBd47B05 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR379225 RBd48B01 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR379351 RBd48G07 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR380505 RBd51E09 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR380529 RBd51F09 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR380898 RBd52E02 pGCAP10 NM_006013.2  
GATATAAGCCATGCGCAGGCGGAGGAGCGCCTCTTTCCCTTCGGTGTGCCACTGAAGATC
HKR382482 RBd56D10 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR383371 RBd58H03 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCNNNNNCCGCCGCCCCGCC
HKR384058 RBd60C10 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR384101 RBd60E05 pGCAP10 NM_006013.2  
GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR385373 RBd63H05 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR385752 RBd64G08 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR386805 RBd67A05 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGGTGAGTAAGCGCAGTTGTCGTCTCTTGCGGTGCCGTTGCTG
HKR387373 RBd68H05 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGGTGAGTAAGCGCAGTTGTCGTCTCTTGCGGTGCCGTTGCTG
HKR389601 RBd74A01 pGCAP10 NM_006013.2  
GGAAAGTCTTAAATTGGGTGACCTGAGCTGTGCAATGATAATGCGGCGATTTTGTAGTAC
HKR389682 RBd74D10 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR390148 RBd75G04 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR390572 RBd76H04 pGCAP10 NM_006013.2  
GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR391658 RBd79C10 pGCAP10 NM_006013.2  
GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR392497 RBd81E01 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR393230 RBd83B06 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR395602 RBd89A02 pGCAP10 NM_006013.2  
GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR397226 RBd93B02 pGCAP10 NM_006013.2  
GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR397604 RBd94A04 pGCAP10 NM_006013.2  
GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR397636 RBd94B12 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR398903 RBd97E07 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR398948 RBd97G04 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR399210 RBd98A10 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR402920 RBdS007E24 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR403094 RBdS007M06 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR405248 RBdS013B24 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGGTGAGTAAGCGCAGTTGTCGTCTCTTGCGGTGCCGTTGCTG
HKR405259 RBdS013C11 pGCAP10 NM_006013.2  
GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR405697 RBdS014E01 pGCAP10 NM_006013.2  
GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR405742 RBdS014F22 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR406157 RBdS015G13 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR406195 RBdS015I03 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR406222 RBdS015J06 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR406305 RBdS015M17 pGCAP10 NM_006013.2  
GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR409071 RBdS022L07 pGCAP10 NM_006013.2  
GTCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR409119 RBdS022N07 pGCAP10 NM_006013.2  
ATGTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR416095 RBdS040D23 pGCAP10 NM_006013.2  
GCNCTTTCCCTNNCNNATGNCCNTCAGGATNNCGGGGTCNNCCTGGGCCNGCACNNCNCC
HKR416295 RBdS040M07 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR420746 RBdS051O10 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR428193 RBdS070I01 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR428236 RBdS070J20 pGCAP10 NM_006013.2  
GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC
HKR430365 RBdS075P05 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR432468 RBdS081C20 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGGTGAGTAAGCGCAGTTGTCGTCTCTTGCGGTGCCGTTGCTG
HKR432719 RBdS081N07 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR433241 RBdS083B17 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR433523 RBdS083N11 pGCAP10 NM_006013.2  
TGCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGC
HKR441882 RBdS104L18 pGCAP10 NM_006013.2  
CCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR441888 RBdS104L24 pGCAP10 NM_006013.2  
GCTTTTCCCTTCGGTGTGGTGAGTAAGCGCAGTTGTCGTCTCTTGCGGTGCCGTTGCTGG
HKR442181 RBdS105H13 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR442287 RBdS105L23 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR444013 RBdS110A13 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR444209 RBdS110I17 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR444257 RBdS110K17 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR453116 RBdS132N04 pGCAP10 NM_006013.2  
GAGGACTCTATGGTTCTTACGCGCGCAGACAGACCGCCTATATAAGCCATGCGCAGGCGG
HKR461853 RBdS154K13 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR471107 RBdS177M19 pGCAP10 NM_006013.2  
GNCCNTNCCCTNCTTTGCNCCTCNCNNNNNNCTGGNGTCACCNTGNGCCGNCGCTNANGT
HKR475110 RBdS187M22 pGCAP10 NM_006013.2  
GCTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCC
HKR475128 RBdS187N16 pGCAP10 NM_006013.2  
GTCTTTCCCTTCGGTGTGCCACTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl