Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00312

HP ID(1) HP00312
Gene ID(2) 6205
Gene Symbol finder RPS11
Protein Name ribosomal protein S11
RefSeq NM_001015.3
Length of RefSeq (bp) 641
Chromosome 19q13.3
Reference DDBJ accession
UniGene Hs.433529

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe17C07 pKA1U5 GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
ARe26E10 pKA1U5 GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
ARe69G08 pKA1U5 TGCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAA
ARe71B08 pKA1U5 GGCCCCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCT
ARe74G01 pKA1U5 GTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAGCAGCC
ARe79D02 pKA1U5 ATCCTGGGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAGCAGCCGA
ARi09F09 pGCAP10 GCTTCTTTTTTTCNGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAA
ARi18B04 pGCAP10 TTTTTTTTTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTAC
ARi40G06 pGCAP10 GGCCCCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCT
ARi58F10 pGCAP10 TTTTTTTTTTTTTTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTG
ARi67A07 pGCAP10 GCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCA
ARiS023O20 pGCAP10 GCTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAA
ARiS085C06 pGCAP10 TTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAGC
ARiS085E02 pGCAP10 GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
ARiS088A22 pGCAP10 GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
ARiS088J19 pGCAP10 GCCCCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTA
ARiS096M23 pGCAP10 ACTTTTTTTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTAC
ARiS122D09 pGCAP10 TTTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
ARiS122D14 pGCAP10 CTTTTTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAA
ARiS198D03 pGCAP10 GCTTTTTTTTTTCAGGCGGCCGGGAAGANGGCGGACATTCAGACTGAGCGTGCCTACCAA
ARiS198N17 pGCAP10 GGCTGCCCCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTG
RBb16B08 pKA1U5 ATCCTGCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACC
RBb19C08 pKA1U5 GCCCCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTA
RBb45E04 pGCAP1 TGGAGACTTCCTCTCCAGCCCCTGCGTAATCGATAAGGAAACCCGGACGCTGCTGCCCCT
RBb54B10 pGCAP1 GCTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAA
RBb69B05 pGCAP1 GGACTCTCGCGAGACACCGTCTAGCACTTCCCGCCCGTCAGTCCTTCACAGTGCCCGAAT
RBd06F12 pGCAP10 GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
RBd10G05 pGCAP10 GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
RBd12C08 pGCAP10 GGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAGCAGCCGACCAT
RBd24B05 pGCAP10 GGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAGCAGCCGACCATCTTTCA
RBd27G10 pGCAP10 GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGTCATTCAGACTGAGCGTGCCTACCAAAAG
RBd31D02 pGCAP10 TTTCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTAC
RBd36A05 pGCAP10 GTTTCTTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCT
RBd41A09 pGCAP10 GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
RBd44F10 pGCAP10 GGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAGCAGCCGACCATCT
RBd47C01 pGCAP10 GCCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACC
RBd57F05 pGCAP10 GCTTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCNNACTGAGCGTGCCTACC
RBd66F11 pGCAP10 GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
RBd79A03 pGCAP10 GCTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAA
RBd93A12 pGCAP10 GTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAA
RBd96G04 pGCAP10 GTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAA
RBdS022N24 pGCAP10 GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
RBdS075P12 pGCAP10 GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
RBdS081L04 pGCAP10 GCTTTATCTTTCCTATCCTTTCAGGCTATTGAGGGCACCTACATTGACAAGAAATGCCCC
RBdS081N12 pGCAP10 GCTTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACC
RBdS104E02 pGCAP10 GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
RBdS110A06 pGCAP10 GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
RBdS132J12 pGCAP10 GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
RBdS177B13 pGCAP10 GCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl