Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075P12

Clone ID RBdS075P12
HP ID HP00312
Gene ID 6205
Gene Symbol RPS11
Protein Name ribosomal protein S11
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001015.3
Length of RefSeq (bp) 641
Chromosome 19q13.3
Reference DDBJ accession
UniGene Hs.433529
5'-terminal sequence GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
2011.08.28