Prev. |  KEGG KO K02949 > 

RIKEN DNA Bank Human Resource - RPS11

Gene ID NCBI Gene 6205 |  KEGG hsa:6205
Gene Symbol RPS11
Protein Name ribosomal protein S11
Synonyms S11
Ortholog resources KEGG ortholog (KEGG orthology K02949) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088222 IRAL020J06 pOTB7 BC007945 NM_001015 Full
HGY089053 IRAL022K13 pOTB7 BC007283 NM_001015 Full
HGY089132 IRAL022N20 pOTB7 BC007603 NM_001015 Full
HGY090855 IRAL027C07 pOTB7 BC010028 NM_001015 Full
HGY095383 IRAL038H15 pDNR-LIB BC016378 NM_001015 Full
HGY102991 IRAL057H23 pDNR-LIB BC070224 NM_001015 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046855 ARe17C07 pKA1U5 NM_001015.3  
GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
HKR050506 ARe26E10 pKA1U5 NM_001015.3  
GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
HKR067752 ARe69G08 pKA1U5 NM_001015.3  
TGCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAA
HKR068432 ARe71B08 pKA1U5 NM_001015.3  
GGCCCCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCT
HKR069745 ARe74G01 pKA1U5 NM_001015.3  
GTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAGCAGCC
HKR071674 ARe79D02 pKA1U5 NM_001015.3  
ATCCTGGGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAGCAGCCGA
HKR163729 ARi09F09 pGCAP10 NM_001015.3  
GCTTCTTTTTTTCNGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAA
HKR167228 ARi18B04 pGCAP10 NM_001015.3  
TTTTTTTTTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTAC
HKR176150 ARi40G06 pGCAP10 NM_001015.3  
GGCCCCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCT
HKR183330 ARi58F10 pGCAP10 NM_001015.3  
TTTTTTTTTTTTTTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTG
HKR186807 ARi67A07 pGCAP10 NM_001015.3  
GCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCA
HKR209556 ARiS023O20 pGCAP10 NM_001015.3  
GCTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAA
HKR234054 ARiS085C06 pGCAP10 NM_001015.3  
TTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAGC
HKR234098 ARiS085E02 pGCAP10 NM_001015.3  
GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
HKR235222 ARiS088A22 pGCAP10 NM_001015.3  
GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
HKR235435 ARiS088J19 pGCAP10 NM_001015.3  
GCCCCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTA
HKR238711 ARiS096M23 pGCAP10 NM_001015.3  
ACTTTTTTTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTAC
HKR248881 ARiS122D09 pGCAP10 NM_001015.3  
TTTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
HKR248886 ARiS122D14 pGCAP10 NM_001015.3  
CTTTTTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAA
HKR279275 ARiS198D03 pGCAP10 NM_001015.3  
GCTTTTTTTTTTCAGGCGGCCGGGAAGANGGCGGACATTCAGACTGAGCGTGCCTACCAA
HKR279529 ARiS198N17 pGCAP10 NM_001015.3  
GGCTGCCCCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTG
HKR326432 RBb16B08 pKA1U5 NM_001015.3  
ATCCTGCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACC
HKR327656 RBb19C08 pKA1U5 NM_001015.3  
GCCCCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTA
HKR338100 RBb45E04 pGCAP1 NM_001015.3  
TGGAGACTTCCTCTCCAGCCCCTGCGTAATCGATAAGGAAACCCGGACGCTGCTGCCCCT
HKR341634 RBb54B10 pGCAP1 NM_001015.3  
GCTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAA
HKR347629 RBb69B05 pGCAP1 NM_001015.3  
GGACTCTCGCGAGACACCGTCTAGCACTTCCCGCCCGTCAGTCCTTCACAGTGCCCGAAT
HKR362532 RBd06F12 pGCAP10 NM_001015.3  
GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
HKR364149 RBd10G05 pGCAP10 NM_001015.3  
GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
HKR364856 RBd12C08 pGCAP10 NM_001015.3  
GGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAGCAGCCGACCAT
HKR369629 RBd24B05 pGCAP10 NM_001015.3  
GGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAGCAGCCGACCATCTTTCA
HKR370954 RBd27G10 pGCAP10 NM_001015.3  
GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGTCATTCAGACTGAGCGTGCCTACCAAAAG
HKR372474 RBd31D02 pGCAP10 NM_001015.3  
TTTCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTAC
HKR374405 RBd36A05 pGCAP10 NM_001015.3  
GTTTCTTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCT
HKR376409 RBd41A09 pGCAP10 NM_001015.3  
GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
HKR377730 RBd44F10 pGCAP10 NM_001015.3  
GGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAGCAGCCGACCATCT
HKR378849 RBd47C01 pGCAP10 NM_001015.3  
GCCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACC
HKR382925 RBd57F05 pGCAP10 NM_001015.3  
GCTTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCNNACTGAGCGTGCCTACC
HKR386531 RBd66F11 pGCAP10 NM_001015.3  
GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
HKR391603 RBd79A03 pGCAP10 NM_001015.3  
GCTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAA
HKR397212 RBd93A12 pGCAP10 NM_001015.3  
GTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAA
HKR398548 RBd96G04 pGCAP10 NM_001015.3  
GTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAA
HKR409136 RBdS022N24 pGCAP10 NM_001015.3  
GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
HKR430372 RBdS075P12 pGCAP10 NM_001015.3  
GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
HKR432668 RBdS081L04 pGCAP10 NM_001015.3  
GCTTTATCTTTCCTATCCTTTCAGGCTATTGAGGGCACCTACATTGACAAGAAATGCCCC
HKR432724 RBdS081N12 pGCAP10 NM_001015.3  
GCTTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACC
HKR441698 RBdS104E02 pGCAP10 NM_001015.3  
GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
HKR444006 RBdS110A06 pGCAP10 NM_001015.3  
GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
HKR453028 RBdS132J12 pGCAP10 NM_001015.3  
GCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAG
HKR470837 RBdS177B13 pGCAP10 NM_001015.3  
GCTTTCTTTTTTTCAGGCGGCCGGGAAGATGGCGGACATTCAGACTGAGCGTGCCTACCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl