Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00308

HP ID(1) HP00308
Gene ID(2) 6233
Gene Symbol finder RPS27A
Protein Name ribosomal protein S27a
RefSeq NM_002954.4
Length of RefSeq (bp) 751
Chromosome 2p16
Reference DDBJ accession
UniGene Hs.546292

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05A02 pKA1U5 TCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
ARe06A09 pKA1U5 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
ARe08A11 pKA1U5 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
ARe13C12 pKA1U5 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
ARe15C06 pKA1U5 TGGCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAA
ARe22G11 pKA1U5 GCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
ARe23E07 pKA1U5 GGTTCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGT
ARe31A05 pKA1U5 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
ARe34B04 pKA1U5 GGTGGGCCTGCGCGGCGTTCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAA
ARe35C04 pKA1U5 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCNACCAAAATGCAGATTTTCGTGAA
ARe44H01 pKA1U5 GGTTCTTCCTTTTCGATCCGCCATCTGCGGTGCCNTTTNCCACCAAAATGCAGATTTTCG
ARe47D11 pKA1U5 GATCTGCGGTGGGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCT
ARe51H11 pKA1U5 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
ARe53B10 pKA1U5 GGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACCCTTACG
ARe72A12 pKA1U5 GGGTGGGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTG
ARe76F11 pKA1U5 GCTTCCTTTTCGATCCGCCATCTGCGGTGGANCCGNCACCAAAATGCAGATTTTCGTGAA
ARf05B11 pKA1U5 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
ARi11A03 pGCAP10 TGCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGA
ARi40H08 pGCAP10 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
ARi43G07 pGCAP10 TTTTTTTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
ARi44G11 pGCAP10 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
ARi56G10 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
ARi69E03 pGCAP10 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
ARiS008H19 pGCAP10 GGGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTGATCC
ARiS013H16 pGCAP10 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
ARiS013K14 pGCAP10 CGGCCGGCCGATATCGTGTGGTACCGCGGCCGCGGATCTCCCTTTAGTGAGGGTTAATTG
ARiS045O13 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
ARiS055B01 pGCAP10 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
ARiS085I13 pGCAP10 GCTTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
ARiS150K05 pGCAP10 GCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
ARiS161M14 pGCAP10 GCTTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
ARiS161N19 pGCAP10 GAGGCNCTNCCGGGCCGGCGCTGGGGNNNGAANGANGANAAGGANAAGCGNCGCCTCGAC
ARiS191I09 pGCAP10 GGTGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTGATC
RBb02E06 pKA1U5 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
RBb07D01 pKA1U5 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCNAAATGCAGATTTTCGTGAAAACC
RBb07F10 pKA1U5 TGCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGA
RBb09D02 pKA1U5 GCTTTTTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
RBb39F03 pGCAP1 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
RBb61D11 pGCAP1 CGGTTCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCG
RBb62G03 pGCAP1
RBb67E09 pGCAP1 TCTTTTTTTTTTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTC
RBb69F09 pGCAP1 GGCCATCTGCGGTGGGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCT
RBd01C05 pGCAP10 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
RBd04D02 pGCAP10 GCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
RBd06H04 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
RBd09A09 pGCAP10 CCTGCGCGGCGTTCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCA
RBd13D08 pGCAP10 TGCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
RBd13H03 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
RBd17F02 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
RBd21B09 pGCAP10 TAAAGATAAAATTTGAAATCTGGTTAGGCTGGTGTTAGGGTTCTTTGTTTTTGGGGTTTG
RBd21B10 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
RBd21H10 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
RBd23B07 pGCAP10 GCTTCCTTTTCGATCCACCATCTGCGGGGGAACCGCCATCTCGGGCTCNATTTTCNTGAA
RBd23B10 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
RBd24H12 pGCAP10 GGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTGATCCCTG
RBd26G09 pGCAP10 GGTTCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGT
RBd28C05 pGCAP10 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
RBd28H03 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
RBd31H04 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
RBd57H07 pGCAP10 GGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTNCNNNNNNNNNCCCTGACCT
RBd61A10 pGCAP10 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
RBd84E01 pGCAP10 GCTTTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAA
RBd95C07 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
RBdS007D13 pGCAP10 GCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
RBdS014D21 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
RBdS014O04 pGCAP10 GGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTGATCCCTG
RBdS015E06 pGCAP10 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
RBdS015P14 pGCAP10 GCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
RBdS040N09 pGCAP10 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
RBdS070F21 pGCAP10 GGTTCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGT
RBdS075O06 pGCAP10 GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
RBdS104A06 pGCAP10 GCTTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGA
RBdS110D22 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
RBdS154J24 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
RBdS156M18 pGCAP10 GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
RBdS177B19 pGCAP10 TTTTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
RBdS177I02 pGCAP10 GGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTGATCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl