Prev. |  KEGG KO K02977 > 

RIKEN DNA Bank Human Resource - RPS27A

Gene ID NCBI Gene 6233 |  KEGG hsa:6233
Gene Symbol RPS27A
Protein Name ribosomal protein S27a
Synonyms CEP80|HEL112|S27A|UBA80|UBC|UBCEP1|UBCEP80
Ortholog resources KEGG ortholog (KEGG orthology K02977) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15747 mCherry-Ubiquitin Expression vector of human ubiquitin.

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX046137 IRAK115F17 pCMV-SPORT6 BC053371 NM_002954 Full/var
HGY067418 IRAK168J02 pBluescriptR BC066293 NM_002954 Full
HGY081899 IRAL004M11 pOTB7 BC001392 NM_002954 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE013212 W01A033A12 pENTR-TOPO IRAL004M11 BC001392 NM_002954  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042002 ARe05A02 pKA1U5 NM_002954.4  
TCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR042409 ARe06A09 pKA1U5 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR043211 ARe08A11 pKA1U5 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR045260 ARe13C12 pKA1U5 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR046054 ARe15C06 pKA1U5 NM_002954.4  
TGGCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAA
HKR048955 ARe22G11 pKA1U5 NM_002954.4  
GCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
HKR049303 ARe23E07 pKA1U5 NM_002954.4  
GGTTCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGT
HKR052405 ARe31A05 pKA1U5 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR053628 ARe34B04 pKA1U5 NM_002954.4  
GGTGGGCCTGCGCGGCGTTCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAA
HKR054052 ARe35C04 pKA1U5 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCNACCAAAATGCAGATTTTCGTGAA
HKR057769 ARe44H01 pKA1U5 NM_002954.4  
GGTTCTTCCTTTTCGATCCGCCATCTGCGGTGCCNTTTNCCACCAAAATGCAGATTTTCG
HKR058883 ARe47D11 pKA1U5 NM_002954.4  
GATCTGCGGTGGGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCT
HKR060579 ARe51H11 pKA1U5 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR061234 ARe53B10 pKA1U5 NM_002954.4  
GGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACCCTTACG
HKR068812 ARe72A12 pKA1U5 NM_002954.4  
GGGTGGGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTG
HKR070531 ARe76F11 pKA1U5 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGANCCGNCACCAAAATGCAGATTTTCGTGAA
HKR082035 ARf05B11 pKA1U5 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR164403 ARi11A03 pGCAP10 NM_002954.4  
TGCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGA
HKR176176 ARi40H08 pGCAP10 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR177351 ARi43G07 pGCAP10 NM_002954.4  
TTTTTTTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR177755 ARi44G11 pGCAP10 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR182554 ARi56G10 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR187699 ARi69E03 pGCAP10 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR203387 ARiS008H19 pGCAP10 NM_002954.4  
GGGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTGATCC
HKR205384 ARiS013H16 pGCAP10 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR205454 ARiS013K14 pGCAP10 NM_002954.4  
CGGCCGGCCGATATCGTGTGGTACCGCGGCCGCGGATCTCCCTTTAGTGAGGGTTAATTG
HKR218349 ARiS045O13 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR222025 ARiS055B01 pGCAP10 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR234205 ARiS085I13 pGCAP10 NM_002954.4  
GCTTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
HKR260245 ARiS150K05 pGCAP10 NM_002954.4  
GCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
HKR264702 ARiS161M14 pGCAP10 NM_002954.4  
GCTTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
HKR264731 ARiS161N19 pGCAP10 NM_002954.4  
GAGGCNCTNCCGGGCCGGCGCTGGGGNNNGAANGANGANAAGGANAAGCGNCGCCTCGAC
HKR276601 ARiS191I09 pGCAP10 NM_002954.4  
GGTGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTGATC
HKR320902 RBb02E06 pKA1U5 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR322873 RBb07D01 pKA1U5 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCNAAATGCAGATTTTCGTGAAAACC
HKR322930 RBb07F10 pKA1U5 NM_002954.4  
TGCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGA
HKR323674 RBb09D02 pKA1U5 NM_002954.4  
GCTTTTTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR335723 RBb39F03 pGCAP1 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR344483 RBb61D11 pGCAP1 NM_002954.4  
CGGTTCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCG
HKR344947 RBb62G03 pGCAP1 NM_002954.4  
HKR346905 RBb67E09 pGCAP1 NM_002954.4  
TCTTTTTTTTTTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTC
HKR347729 RBb69F09 pGCAP1 NM_002954.4  
GGCCATCTGCGGTGGGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCT
HKR360453 RBd01C05 pGCAP10 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR361674 RBd04D02 pGCAP10 NM_002954.4  
GCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
HKR362572 RBd06H04 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR363609 RBd09A09 pGCAP10 NM_002954.4  
CCTGCGCGGCGTTCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCA
HKR365280 RBd13D08 pGCAP10 NM_002954.4  
TGCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
HKR365371 RBd13H03 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR366922 RBd17F02 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR368433 RBd21B09 pGCAP10 NM_002954.4  
TAAAGATAAAATTTGAAATCTGGTTAGGCTGGTGTTAGGGTTCTTTGTTTTTGGGGTTTG
HKR368434 RBd21B10 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR368578 RBd21H10 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR369231 RBd23B07 pGCAP10 NM_002954.4  
GCTTCCTTTTCGATCCACCATCTGCGGGGGAACCGCCATCTCGGGCTCNATTTTCNTGAA
HKR369234 RBd23B10 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR369780 RBd24H12 pGCAP10 NM_002954.4  
GGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTGATCCCTG
HKR370553 RBd26G09 pGCAP10 NM_002954.4  
GGTTCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGT
HKR371253 RBd28C05 pGCAP10 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR371371 RBd28H03 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR372572 RBd31H04 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR382975 RBd57H07 pGCAP10 NM_002954.4  
GGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTNCNNNNNNNNNCCCTGACCT
HKR384410 RBd61A10 pGCAP10 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR393697 RBd84E01 pGCAP10 NM_002954.4  
GCTTTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAA
HKR398055 RBd95C07 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR402885 RBdS007D13 pGCAP10 NM_002954.4  
GCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
HKR405693 RBdS014D21 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR405940 RBdS014O04 pGCAP10 NM_002954.4  
GGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTGATCCCTG
HKR406102 RBdS015E06 pGCAP10 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR406374 RBdS015P14 pGCAP10 NM_002954.4  
GCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
HKR416321 RBdS040N09 pGCAP10 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR428141 RBdS070F21 pGCAP10 NM_002954.4  
GGTTCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGT
HKR430342 RBdS075O06 pGCAP10 NM_002954.4  
GCTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAA
HKR441606 RBdS104A06 pGCAP10 NM_002954.4  
GCTTTCCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGA
HKR444094 RBdS110D22 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR461840 RBdS154J24 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR462706 RBdS156M18 pGCAP10 NM_002954.4  
GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
HKR470843 RBdS177B19 pGCAP10 NM_002954.4  
TTTTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAAC
HKR470994 RBdS177I02 pGCAP10 NM_002954.4  
GGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTGATCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.11

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl