Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110D22

Clone ID RBdS110D22
HP ID HP00308
Gene ID 6233
Gene Symbol RPS27A
Protein Name ribosomal protein S27a
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002954.4
Length of RefSeq (bp) 751
Chromosome 2p16
Reference DDBJ accession
UniGene Hs.546292
5'-terminal sequence GCTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACC
2011.08.28