Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00305

HP ID(1) HP00305
Gene ID(2) 6147
Gene Symbol finder RPL23A
Protein Name ribosomal protein L23a
RefSeq NM_000984.5
Length of RefSeq (bp) 979
Chromosome 17q11
Reference DDBJ accession
UniGene Hs.419463

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03A07 pKA1U5 ATCCTGNTCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTA
ARe03E03 pKA1U5 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARe04F07 pKA1U5 ACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCAAAG
ARe07E12 pKA1U5 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARe12H06 pKA1U5 GCTTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTG
ARe17A01 pKA1U5 ATCCTGGCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAA
ARe18E08 pKA1U5 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARe25E07 pKA1U5 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARe28D06 pKA1U5 GCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARe28F02 pKA1U5 GGACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGC
ARe28H12 pKA1U5 ATCCTGGCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAA
ARe40A08 pKA1U5 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARe41C07 pKA1U5 TTCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARe44D12 pKA1U5 GGGCTGTGGGTGTGGTACTGAGGCTTCAGCGNCCNNTNNACCGCCTAGAGGGAGTGGAGC
ARe47G11 pKA1U5 GCCTTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARe48A09 pKA1U5 GCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARe50D12 pKA1U5 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARe57G03 pKA1U5 GCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARe72E03 pKA1U5 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARe76D01 pKA1U5 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAANNAATTTTCCTGCCCCTCCTAAAGCTGA
ARe77H01 pKA1U5 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAANCCTTTNTCCTGCCCCTCCTAAAGCTGA
ARe82E03 pKA1U5 GCCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARe83G06 pKA1U5 GCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARe86D05 pKA1U5 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARe86G12 pKA1U5 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARe87E11 pKA1U5 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARe87H12 pKA1U5 GCTTTTCACACCANGGNGNCNAAAGCGAANAACNATGCTCCTGCCCCCTCCTAANGTTGA
ARe88A07 pKA1U5 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARf02A09 pKA1U5 GCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARf04E08 pKA1U5 GACACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCA
ARi04G06 pGCAP10 GTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARi18G04 pGCAP10 GCCTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTG
ARi23C02 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARi24F12 pGCAP10 GATTGGAGACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCC
ARi32A01 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARi43E01 pGCAP10 GGACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGC
ARi48F06 pGCAP10 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARi59E10 pGCAP10 GCCTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTG
ARi63A07 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARi66D10 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARiS008K22 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARiS008P17 pGCAP10 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARiS013K11 pGCAP10 GATTGGANACCCTTNNCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCC
ARiS023C09 pGCAP10 GCCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTG
ARiS023E01 pGCAP10 CGGCCGGCCGATGCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCT
ARiS045J01 pGCAP10 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARiS049D13 pGCAP10 GCTTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTG
ARiS055L24 pGCAP10 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARiS085A13 pGCAP10 GACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCT
ARiS087J19 pGCAP10
ARiS087O12 pGCAP10 GCTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARiS088G10 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARiS088L13 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARiS109A07 pGCAP10 TAGTTTTTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAA
ARiS109B12 pGCAP10 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
ARiS150H23 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
ARiS161D05 pGCAP10 GCTTTNCNCNNGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
RBb11D07 pKA1U5 GCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
RBb12G06 pKA1U5 TGGAGACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAA
RBb34C12 pGCAP1 TGCCTTTTCACAAGATGCGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCT
RBb38C11 pGCAP1 GCTTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
RBb41E11 pGCAP1 TTGACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAG
RBb50A04 pGCAP1 TGGCTTTTCACAAGGATGGCGCCGAAAAGCGAAGAAGGAAGCCTCCTGCCCCTCCTAAAG
RBb60H09 pGCAP1 TTTTTTTTTTTTTTGCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCC
RBb67F07 pGCAP1 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
RBb68D10 pGCAP1 TTCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTG
RBb72H06 pGCAP1 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
RBd01H04 pGCAP10 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTAAA
RBd01H10 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
RBd07C04 pGCAP10 GCCCTTTTTCCNGCNGGNGCCAAGGAGGGTGAAGGNANCTCCTGCCCCTCCTAAAGNNGN
RBd17E06 pGCAP10 CAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCAAAGC
RBd21A05 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
RBd23F10 pGCAP10 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
RBd33C11 pGCAP10 GACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCAAA
RBd35C05 pGCAP10 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
RBd38F08 pGCAP10 GCTTTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCT
RBd39G07 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
RBd40H04 pGCAP10 TTGTGGCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAG
RBd45C09 pGCAP10 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
RBd55A06 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCNNNNNNNCCTAAAGCTGA
RBd77H10 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
RBd79F12 pGCAP10 GCCCTTTTCACAAGATGGCGCCNAAAGCNNANAAGGAACCTCCTGCCCCTCCTAAAGCTG
RBd81B11 pGCAP10 GACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCAAA
RBd81D04 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
RBd85A06 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
RBd87F04 pGCAP10 GACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCAAA
RBd87H02 pGCAP10 GACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCT
RBd92F03 pGCAP10 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
RBd99C12 pGCAP10 GACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCT
RBdS014F01 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
RBdS022N19 pGCAP10 GACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCT
RBdS083L18 pGCAP10 CGCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTG
RBdS105B03 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
RBdS105N05 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
RBdS154C09 pGCAP10 GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
RBdS177G06 pGCAP10 GACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCT
RBdS177J13 pGCAP10 GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl