Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - ARe47G11

Clone ID ARe47G11
HP ID HP00305
Gene ID 6147
Gene Symbol RPL23A
Protein Name ribosomal protein L23a
Vector pKA1U5
Accession No. in DDBJ
RefSeq NM_000984.5
Length of RefSeq (bp) 979
Chromosome 17q11
Reference DDBJ accession
UniGene Hs.419463
5'-terminal sequence GCCTTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
2011.08.28