Prev. |  KEGG KO K02893 > 

RIKEN DNA Bank Human Resource - RPL23A

Gene ID NCBI Gene 6147 |  KEGG hsa:6147
Gene Symbol RPL23A
Protein Name ribosomal protein L23a
Synonyms L23A|MDA20
Ortholog resources KEGG ortholog (KEGG orthology K02893) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY103103 IRAL057M15 pDNR-LIB BC070191 NM_000984.6 Partial
HGY099531 IRAL048N19 pDNR-LIB BC058041 NM_000984 Full
HGY093889 IRAL034M01 pOTB7 BC014459 NM_000984 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE084046 M01C010B22 pDONR221 FLJ02-H11 AK130965 NM_178170  
HGE084094 M01C010D22 pDONR221 FLJ02-H11 AK130965 NM_178170  
HGE084142 M01C010F22 pDONR221 FLJ02-H11 AK130965 NM_178170  
HGE084190 M01C010H22 pDONR221 FLJ02-H11 AK130965 NM_178170  
HGE084238 M01C010J22 pDONR221 FLJ02-H11 AK130965 NM_178170  
HGE084286 M01C010L22 pDONR221 FLJ02-H11 AK130965 NM_178170  
HGE084334 M01C010N22 pDONR221 FLJ02-H11 AK130965 NM_178170  
HGE084382 M01C010P22 pDONR221 FLJ02-H11 AK130965 NM_178170  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041207 ARe03A07 pKA1U5 NM_000984.5  
ATCCTGNTCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTA
HKR041299 ARe03E03 pKA1U5 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR041727 ARe04F07 pKA1U5 NM_000984.5  
ACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCAAAG
HKR042908 ARe07E12 pKA1U5 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR044974 ARe12H06 pKA1U5 NM_000984.5  
GCTTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTG
HKR046801 ARe17A01 pKA1U5 NM_000984.5  
ATCCTGGCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAA
HKR047304 ARe18E08 pKA1U5 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR050103 ARe25E07 pKA1U5 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR051278 ARe28D06 pKA1U5 NM_000984.5  
GCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR051322 ARe28F02 pKA1U5 NM_000984.5  
GGACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGC
HKR051380 ARe28H12 pKA1U5 NM_000984.5  
ATCCTGGCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAA
HKR056008 ARe40A08 pKA1U5 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR056455 ARe41C07 pKA1U5 NM_000984.5  
TTCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR057684 ARe44D12 pKA1U5 NM_000984.5  
GGGCTGTGGGTGTGGTACTGAGGCTTCAGCGNCCNNTNNACCGCCTAGAGGGAGTGGAGC
HKR058955 ARe47G11 pKA1U5 NM_000984.5  
GCCTTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR059209 ARe48A09 pKA1U5 NM_000984.5  
GCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR060084 ARe50D12 pKA1U5 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR062947 ARe57G03 pKA1U5 NM_000984.5  
GCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR068899 ARe72E03 pKA1U5 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR070473 ARe76D01 pKA1U5 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAANNAATTTTCCTGCCCCTCCTAAAGCTGA
HKR070969 ARe77H01 pKA1U5 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAANCCTTTNTCCTGCCCCTCCTAAAGCTGA
HKR072899 ARe82E03 pKA1U5 NM_000984.5  
GCCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR073350 ARe83G06 pKA1U5 NM_000984.5  
GCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR074477 ARe86D05 pKA1U5 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR074556 ARe86G12 pKA1U5 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR074907 ARe87E11 pKA1U5 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR074980 ARe87H12 pKA1U5 NM_000984.5  
GCTTTTCACACCANGGNGNCNAAAGCGAANAACNATGCTCCTGCCCCCTCCTAANGTTGA
HKR075207 ARe88A07 pKA1U5 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR080809 ARf02A09 pKA1U5 NM_000984.5  
GCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR081704 ARf04E08 pKA1U5 NM_000984.5  
GACACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCA
HKR161750 ARi04G06 pGCAP10 NM_000984.5  
GTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR167348 ARi18G04 pGCAP10 NM_000984.5  
GCCTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTG
HKR169250 ARi23C02 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR169732 ARi24F12 pGCAP10 NM_000984.5  
GATTGGAGACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCC
HKR172801 ARi32A01 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR177297 ARi43E01 pGCAP10 NM_000984.5  
GGACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGC
HKR179326 ARi48F06 pGCAP10 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR183706 ARi59E10 pGCAP10 NM_000984.5  
GCCTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTG
HKR185207 ARi63A07 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR186482 ARi66D10 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR203462 ARiS008K22 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR203577 ARiS008P17 pGCAP10 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR205451 ARiS013K11 pGCAP10 NM_000984.5  
GATTGGANACCCTTNNCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCC
HKR209257 ARiS023C09 pGCAP10 NM_000984.5  
GCCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTG
HKR209297 ARiS023E01 pGCAP10 NM_000984.5  
CGGCCGGCCGATGCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCT
HKR218217 ARiS045J01 pGCAP10 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR219685 ARiS049D13 pGCAP10 NM_000984.5  
GCTTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTG
HKR222288 ARiS055L24 pGCAP10 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR234013 ARiS085A13 pGCAP10 NM_000984.5  
GACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCT
HKR235035 ARiS087J19 pGCAP10 NM_000984.5  
HKR235148 ARiS087O12 pGCAP10 NM_000984.5  
GCTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR235354 ARiS088G10 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR235477 ARiS088L13 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR243607 ARiS109A07 pGCAP10 NM_000984.5  
TAGTTTTTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAA
HKR243636 ARiS109B12 pGCAP10 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR260191 ARiS150H23 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR264477 ARiS161D05 pGCAP10 NM_000984.5  
GCTTTNCNCNNGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR324479 RBb11D07 pKA1U5 NM_000984.5  
GCCTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR324950 RBb12G06 pKA1U5 NM_000984.5  
TGGAGACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAA
HKR333660 RBb34C12 pGCAP1 NM_000984.5  
TGCCTTTTCACAAGATGCGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCT
HKR335259 RBb38C11 pGCAP1 NM_000984.5  
GCTTTTTCCAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR336507 RBb41E11 pGCAP1 NM_000984.5  
TTGACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAG
HKR340004 RBb50A04 pGCAP1 NM_000984.5  
TGGCTTTTCACAAGGATGGCGCCGAAAAGCGAAGAAGGAAGCCTCCTGCCCCTCCTAAAG
HKR344177 RBb60H09 pGCAP1 NM_000984.5  
TTTTTTTTTTTTTTGCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCC
HKR346927 RBb67F07 pGCAP1 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR347282 RBb68D10 pGCAP1 NM_000984.5  
TTCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTG
HKR348974 RBb72H06 pGCAP1 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR360572 RBd01H04 pGCAP10 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTAAA
HKR360578 RBd01H10 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR362852 RBd07C04 pGCAP10 NM_000984.5  
GCCCTTTTTCCNGCNGGNGCCAAGGAGGGTGAAGGNANCTCCTGCCCCTCCTAAAGNNGN
HKR366902 RBd17E06 pGCAP10 NM_000984.5  
CAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCAAAGC
HKR368405 RBd21A05 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR369330 RBd23F10 pGCAP10 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR373259 RBd33C11 pGCAP10 NM_000984.5  
GACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCAAA
HKR374053 RBd35C05 pGCAP10 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR375328 RBd38F08 pGCAP10 NM_000984.5  
GCTTTTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCT
HKR375751 RBd39G07 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR376172 RBd40H04 pGCAP10 NM_000984.5  
TTGTGGCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAG
HKR378057 RBd45C09 pGCAP10 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR382006 RBd55A06 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCNNNNNNNCCTAAAGCTGA
HKR390978 RBd77H10 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR391732 RBd79F12 pGCAP10 NM_000984.5  
GCCCTTTTCACAAGATGGCGCCNAAAGCNNANAAGGAACCTCCTGCCCCTCCTAAAGCTG
HKR392435 RBd81B11 pGCAP10 NM_000984.5  
GACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCAAA
HKR392476 RBd81D04 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR394006 RBd85A06 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR394924 RBd87F04 pGCAP10 NM_000984.5  
GACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCAAA
HKR394970 RBd87H02 pGCAP10 NM_000984.5  
GACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCT
HKR396923 RBd92F03 pGCAP10 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA
HKR399660 RBd99C12 pGCAP10 NM_000984.5  
GACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCT
HKR405721 RBdS014F01 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR409131 RBdS022N19 pGCAP10 NM_000984.5  
GACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCT
HKR433482 RBdS083L18 pGCAP10 NM_000984.5  
CGCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTG
HKR442027 RBdS105B03 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR442317 RBdS105N05 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR461657 RBdS154C09 pGCAP10 NM_000984.5  
GCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGA
HKR470950 RBdS177G06 pGCAP10 NM_000984.5  
GACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCT
HKR471029 RBdS177J13 pGCAP10 NM_000984.5  
GCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl